Infectious Diseases – Richard T. Marconi, Christopher Earnhart, Virginia Commonwealth University
Abstract for “Polyvalent Chimeric OspC vaccinegen and diagnostic antibody”
“A chimeric polyvalent, recombinant Lyme protein is provided. The chimeric protein includes epitopes from the loop 5 region, and/or the Alpha Helix 5 region of outer protein C (OspC). OspC may be linked to mammalian Borrelia infections.
Background for “Polyvalent Chimeric OspC vaccinegen and diagnostic antibody”
“1. “1.
“The invention generally refers to a vaccine or diagnostic for Lyme disease. The invention provides a chimeric polyvalent protein recombinant to Lyme’s disease. It includes immunodominant epitopes from loop 5 and/or the alpha helix 5, regions/domains of outer protein C (OspC), types that are associated with mammalian infections.
“2. “2.
Lyme disease is the most widespread arthropod-borne disease in North America, Europe and North America. Borrelia burgdorferi (B. garinii), and B. afzelii (B. afzelii) are the spirochetes that cause it. Transmission to mammals is through the bites of infected Ixodes Ticks [Burgdorfer and al. 1982, Benach and al. 1983]. Lyme disease is associated with significant morbidity. There are places in Europe and the United States where as high as 3% of the population can be infected each year [Fahrer and al., 1991]. Lyme disease is a multi-systemic inflammatory disorder that can cause headaches, low-grade fever, erythema and myalgia. Late-stage clinical manifestations may be severe and include arthritis [Steere and Al., 1997a; Eiffert and al. 1998; Steere and al. 2004], carditis (Asch et.l. 1994; Nagi and al. 1996 Barthold and al. 1991] and neurological complications (Nachman, Pontrelli 2003; Coyle & Schutzer 2002]. Lyme disease can also have significant socio-economic consequences. This is manifested in a reduction in outdoor recreational and other social activities as a result of tick exposure.
“Pharmacoeconomic studies show that there is a clear need for Lyme disease vaccines, especially in areas where the annual risk of contracting the disease exceeds 1% [Meltzer and al. 1999; Shadick and al. 2001]. A vaccine is currently not commercially available. OspA-based LYMErix was the first vaccine for Lyme disease. However, due to a decline in sales, the company pulled it from the market in 2002. Concerns, whether real or perceived, about possible adverse effects, including a chronic inflammatory joint, could explain the decline in sales [Kalish et. al., 1993]. New OspA based vaccines are being developed to address this potential problem [Koide and al. 2005; Willett and al. 2004]. However, there remain questions about the viability or efficacy of an OspA vaccine. The frequency of boosters necessary to sustain long-term protection is a concern. OspA, which is found in tick midgut, is quickly down-regulated by tick feeding and is not expressed on mammals [Gilmore, et. al. 2001; Schwan, et. al. 1995]. OspA-based vaccines work by targeting spirochetes in the tick to prevent their transmission [de Silva and al., 1999]. Effective protection depends on the presence of high levels of anti-OspA antibodies in the circulating bloodstream. This is because transmission can occur within 48 hours after tick feeding. Antigens that are expressed at high levels in early infection can avoid the inherent problems with OspA-based vaccinations. They also elicit bactericidal antibodies.
Lyme disease vaccine development has given OspC a lot of attention. It is a surface-exposed lipoprotein of 22 kDa [Fuchs and al. 1992]. It is encoded on a 26kb circular DNA that is universal between isolates from the B.burgdorferi sensu Lato complex [Marconi, 1993; Sadziene, etg., 1993]. It is expressed by ticks and maintained in early mammalian infection (Schwan, 2004). Anti-OspC antibodies have been demonstrated to protect against infection, but only against strains expressing OspC that is closely related in sequence to the vaccinogen [Gilmore et al., 1996; Bockenstedt et al., 1997; Gilmore and Mbow, 1999; Mathiesen et al., 1998; Scheiblhofer et al., 2003; Jobe et al., 2003; Rousselle et al., 1998; Wallich et al., 2001; Mbow et al., 1999; Probert et al., 1997; Brown et al., 2005; Probert and LeFebvre 1994]. Analysis of OspC sequences has revealed?21 OspC clusters, or types, that can be distinguished by letters (A-U) [Seinost and Wang, 1999; Wang, et. al. 1999]. Although sequence variation within a cluster can be less than 2%, it can reach as high as 22% between OspC types [Wang and Al., 1999; Theisen and Al., 1995; Brisson & Dykhuizen 2004]. This inter-type variation in epitopes is most likely what explains the limited protection provided by vaccination with one OspC type.
“U.S. Pat. No. 6,248,562 (Jun. 6,248,562 (Jun. The chimeric polypeptides in the chimeric protein are derived from any Borrelia strain. They include OspA and OspB and OspC and OspD. These chimeric proteins are useful as immunodiagnostic reagents or vaccine immunogens for Borrelia infection. OspC proteins do not contain loop 5 or alpha 5 epitopes.
“U.S. Pat. Nos. Nos. 6,872,550 (Mar. 6,872,550 and 6,486,130 (Mar. These patents do not mention the characterization loop 5 or alpha 5 epitopes.
“U.S. Pat. No. 7,008,625 (Mar. 7, 2006) to Dattwyler et al. This paper discloses antigenic polypeptides from a variety Borrelia strains, and/or proteins within one protein. The chimeric Borrelia protein is made up of fragments of polypeptides from the outer surface proteins OspA, OspC. These proteins are effective against Lyme Borreliosis and can also be used as immunodiagnostic reagents. The characterization of loop 5 or alpha 5 epitopes is not mentioned.
“The publication ‘Recombinant Chimeric Borrelia proteins for diagnosis of Lyme Disease? (Maria J. C. Gomes-Solecki et al. 2000. J. Clin. Microbiol. 38: 2530-2535). This patent is closely related to the above-mentioned patents. Each chimera contained portions of OspA, OspB and OspC which are key antigenic proteins for Borrelia burgdorferi. Although the paper is primarily focused on diagnosis, it also discusses applications for vaccinogens. Although the authors acknowledge that it is possible to create better chimeras by further studying the genetic variability of important epitopes, they do not mention OspC’s loop 5 or alpha 5 epitopes.
“The prior art has so far failed to provide a vaccine that provides broad protection against multiple OspC types in order to treat Lyme disease prevention and/or treatment.”
“The invention provides a chimeric, polyvalent recombinant protein that can be used as a diagnostic and vaccine for Lyme disease. This invention was partly based on the identification and characterisation of novel protective epitopes from multiple OspC types. Each of these is associated with mammalian (e.g. Lyme disease in humans. These epitopes were identified and made it possible to create a chimeric protein (or proteins) that contains a variety of OspC types. The chimeric recombinant proteins can be used to provide broad protection against OspC-type Borrelia strains. They are also associated with mammalian Lyme diseases. The chimeric protein can also be used as a diagnostic tool for identifying individuals with antibodies to the epitopes and to determine whether an individual has been infected or exposed to Lyme disease causative agent. The epitopes may be B-cell epitopes or immunodominant epitopes in some embodiments.
This invention aims to provide a chimeric protein that contains epitopes from the loop 5 region or the alpha helix5 region of one or more outer surface protein types (OspC). One embodiment of the OspC type selections are Smar, H13 and PFiM. SL10 and PMit. HT22 and HT25. VS461, DK15 and HT25. Another embodiment has an OspC type E, N and I, C, A and B. Yet another embodiment has a primary amino acids sequence as described in SEQ ID No: 75 or SEQID NO: 249. Some OspC types may be associated with invasive Borrelia infections.
“The invention also provides a means to elicit an immune response against Borrelia in an individual who is in need of it. The method involves administering to an individual a chimeric protein containing epitopes from the loop 5 region or the alpha helix5 region of one or more outer surface proteinC (OspC). One embodiment of the invention includes OspCs that are chosen from the following: Smar, H13. PFiM. SL10. PMit. PKi. PKi. HT22. HT25. VS461. HT25. HT25. Lastly, the method comprises the step of administering to the individual a chimeric protein comprising epitopes starting in loop 5 region or alpha helix 5 region of two or more outer surface protein C (OspC): 259. Some embodiments of the OspC types can be associated with invasive Borrelia infections.
The invention also provides a method to determine whether an individual has been infected or exposed to Borrelia. This method involves the following steps: 1) collecting a biological sample from an individual; 2) subjecting the biological sample to at most one recombinant protein chimeric, wherein at least one protein contains epitopes from loop 5, alpha helix 5, or both of the two or more outer protein C (OspC), types; and 3) determining if antibodies in the biological sample bind to at least one of the chimeric proteins. The detection of antibody binding indicates that the individual has been exposed to Borrelia a prior to or was to Borrelia a a a a a a a a chimeric a recombinant a a a a a a a a a a a a a a a sesq ID NO: 75 or SEQ ID NO: 249. One embodiment of this invention includes OspCs that are selected from the following: Smar, PMit and PKi; HT22 and PT25; 2) exposing the biological sample to at least one recombinant chimeric protein, wherein the at least one chimeric protein contains epitopes in loop 5 region or alpha helix 5 regions, or both of these outer surface protein C (OspC) types; and 3) determining whether antibodies in the biological sample bind to the primary amino acids as shown in SEQ ID: 75 and SEQ ID: 249. Some embodiments of the invention associate OspC types with invasive Borrelia infections.
The invention also provides antibodies to a Chimeric Recombinant Protein that includes epitopes in loop 5 or alpha-helix 5 regions of one or more outer surface proteins C (OspC). One embodiment of the invention includes OspCs that are chosen from the following: Smar, PMit. PLi. H13. PFiM. SL10. PMit. PKi. PHbes. HT22. HT25. VS461. HT25. Likewise, epitopes in the loop 5 region or alpha helix 5 region of two or more outer surface protein C (OspC) types. Another embodiment has a primary sequence of amino acids as described in SEQ ID: 2499. Some embodiments of the OspC types may be associated with invasive Borrelia infections. Monoclonal and polyclonal antibodies are possible. One embodiment of the antibody is bactericidal against Borrelia spirochetes.
“The invention also provides an immunogenic cocktail containing chimeric-recombinant proteins. Every chimeric recombinant proteins in the cocktail contains epitopes from loop 5, or alpha-helix 5 regions, or both of two or more outer protein C (OspC).
“The present invention was based on the identification of protective epitopes that are type-specific and specific to OspC types. These epitopes have been associated with Lyme disease infection. Two domains (regions), in OspC’s carboxyl-terminal portion, contain the novel epitopes. None of these domains were previously considered highly immunogenic. The first domain was referred to as the?alpha 5 region/domain. or ?alpha 5 region/domain? or?helix5 region/domain Herein), is located between residues 160-200. It contains secondary structural elements, including loop 6, alphahelix 5, and an unstructured Cterminal domain (Kumaran and al., 2001). The second domain (or loop 5 region/domain) is located between residues 160 and 200. Herein, the second domain (?loop 5 region/domain) is located between residues 131-39 and 159. It contains secondary structural elements such as a portion alpha helix 3, loop 5, and alpha-helix 4, (Kumaran and al. 2001). Each region contains at least one epitope which may be used to practice the present invention. These epitopes, also known as antigenic peptides and polypeptides within these regions, can be used in practice of the invention. They may be used alone or in combination with other epitopes in an chimeric immunegen. The epitopes in some embodiments are immunodominant epitopes. The epitopes are typically B-cell epitopes. However, T-cell epitopes can be included.
“The discovery of novel epitopes and the mapping of epitopes with different OspC type has allowed for the creation of multivalent chimeric protein that contains a variety of linear, type-specific immunodominant epitopes of multiple OspC kinds. The multivalent (polyvalent), recombinant, chimeric protein provides broad protection against infection by Borrelia spirochetes. It is able to be used as a vaccine. Borrelia spirochetes that are highly infectious. The chimeric proteins can also be used as diagnostic tools to determine whether an individual is infected with Lyme disease causative agents.
“The following definitions will help you understand the invention.
Antigen is a term that has been used to denote an entity that is bound to an antibody and the entity that causes the production of that antibody. The meaning of antigen is now limited to the entity bound by antibodies. However, the term ‘immunogen’ is more commonly used. The entity that induces antibody formation is called ‘immunogen’. If an entity is both immunogenic or antigenic, it will be referred to as such according to its intended utility. The terms “antigen”, “immunogen?” are used interchangeably. The terms?antigen?,?immunogen? and?epitope may be interchangeably used herein. The terms?epitope? and?antigenic determinant? may be interchangeable herein. The term is interchangeable with ?antigenic determinant?.\nImmunodominant epitope: The epitope on a molecule that induces the dominant, or most intense, immune response.\nLinear epitope: An epitope comprising a single, non-interrupted, contiguous chain of amino acids joined together by peptide bonds to form a peptide or polypeptide. This epitope is described by its primary structure. the linear sequence of amino acids in the chain.\nConformational epitope: an epitope comprised of at least some amino acids that are not part of an uninterrupted, linear sequence of amino acids, but which are brought into proximity to other residues in the epitope by secondary, tertiary and/or quaternary interactions of the protein. These residues can be far away from the primary sequence of amino acids in the epitope, but they may be found in close proximity to other OspC residues due to protein folding. 23. Kumaran et. al. (2001). (2001). nAlpha Helix 5 region/domain. This is the OspC region that contains residues that correspond with amino acids 160-200 of strain B31 (OspC Type A) sequence, as shown in FIG. 23 and the C-terminal section of the protein (amino acid 201-210 of B31 sequence), are not shown in FIG. 23. The Strain OspC secondary structural elements of Strain B31 OspC are located in the following region: loop 6, alpha-helix 5, and unstructured Cterminal domain. (2001). The terms?protein’ and?polypeptide are interchangeable. The terms?protein?,?polypeptide? and?peptide can be interchangeably used herein. The terms?peptide? and?peptide can be interchanged herein. ?multivalent? Or?multivalent? The number of OspC-specific epitope bearing polypeptides in the chimeric vaccinegen. A divalent chimera could be made up of alpha-helix 5 and alpha-helix 5 from type A, or alpha and loop 5 and type A, respectively. One OspC protein may be associated with invasive infections. If Borrelia OspC types have been isolated from human infections other than the area of tick bite inoculation (e.g. .).”from plasma, cerebrospinal liquid, etc
“The invention provides recombinant, chimeric proteins that contain multiple linear epitopes in the loop 5 or alpha helix 5, at least two of which are different OspC types associated with invasive infections. A single chimeric protein can contain antigenic epitopes that range from 2 to 20 and more preferably, 6 to 10. Although at least two epitopes may be different in primary sequence and come from different OspC types it is possible to include multiple epitopes in a chimera or include several sequences that are derived or based on the original OspC type. Although the number of linear epitopes within a chimera will vary, it is likely to be between 10 and 20. One embodiment of the invention uses immunodominant epitopes that are chosen from OspC type Smar, PMit and SL10, PHi, SL10 and HT22. Other combinations that may be suitable include: 1) E N, I C, A B, K. D; 2) A B, K. D, E N, C; and 3) I C, C. A. B. K. D; and 4) C. A. B. K. D.
“In some embodiments, the loop 5 as well as the alpha helix 5, regions will be included. An?E?, N?, I?, C? A, B? K, D? example. An OspC type E, N,I, C, A. B. K, D. construct could contain both the loop 5 or helix 5 regions. You could include the loop 5 region from type A, as well as the alpha-helix 5 regions from OspC types E, N. I, C. B, K and D. Or, you may only include the loop 5 regions for each OspC type; or the alpha Helix 5 region. Other combinations are possible, too (e.g. Loop 5 region of type A and the alpha-helix 5 region region of type B and K may be included.
“The linear order of epitopes in a chimera can vary. The order from amino to carboxyl terminus will be:?loop 5, alpha-helix 5 area, loop 5, alpha-helix 5 regional, alphahelix 5 regions, alphahelix 5region, and alphahelix 5 area. . . ? etc. In the case of E, N. I, C. A, B. K, and D constructs, the preferred order is:?E-type Loop 5 Region, E-type Alpha Helix 5 Region; N-type Loop 5 Region, N-type Alpha Helix 5 Area; I-type Loop 5 Region, I-type Alpha helix5 region . . ?, etc. The length of the chimera with the OspC types, and/or domains, optionally separated by neutral linking sequences. This order can change depending on elements included in the chimera. You can use any order of OspC domains and OspC types, provided that the resulting chimera generates an appropriate immune response or is effective in diagnosing Lyme disease. FIG. shows some examples of chimera sequences. 25A-J. FIG. shows a tabular representation of the OspC accession numbers from various Borrelia strains. 26.”
“The amino acids sequences in the chimeric proteins may include the alpha helix 5, and/or loop 5 regions or antigenic fragments thereof. By ?antigenic fragment? We mean any segment of OspC that has at least one linear epitope identified during infection. This epitope is expressed in OspC’s recombinant protein unit. It can bind infection-induced antibody in a similar manner to wild-type proteins expressed on the cell surface. One antigenic fragment might contain multiple epitopes. The art of measuring the affinity or avidity for an epitope by antibodies is not always precise. Also, the affinity/avidity may change during the immune response (e.g. By affinity maturations/somatic highmutataiton. The affinity/avidity for binding antibodies to the chimeric proteins is generally between about 50% and 60%. Preferably, it is about 70%. More preferably, about 70%. Most preferably, about 90-100%. This is higher than native, intact alpha 5, or loop 5. The antigenic sequences in the chimeric protein will generally contain between 20 and 100 amino acids. Preferably, they will be between 30 and 70 amino acids. The chimeric protein itself will contain about 160 to 800 amino acids. Preferably, they will have between 240 and 560 amino acid. The antigenic sequences can also be called?epitopes? regardless of whether they contain an entire ‘natural? As long as they have the antibodies binding characteristics described herein, epitopes may be used.
“Alternatively, antigen fragments, antigenic sequences, or epitopes that are appropriate may be identified by their ability to induce suitable antibody production in the epitope when they are included in a Chimeric Protein. The definitions of antibody titre may be different for those skilled in the art. Herein, ?titer? ?titer? is the inverse dilution (or dilute) of an antiserum to bind half the binding sites on an ELISA coated with 100 ng test protein. An antibody titer of about 100 to 100,000 is considered to be suitable for production. Preferably, it should be between 10,000 and 10,000,000. In diagnostic assays, however, the ‘titer’ could be used to indicate whether or not there is a suitable antibody production process. The background level of binding should be at least three times the?titer? To be considered positive, the reactivity measured in a test must be at least three times higher than that detected in serum from healthy individuals. The antibody response should be protective. Prevents or lessens symptoms of disease in a vaccinated person who is later exposed to Borrelia.
FIG. 9B shows the amino acid sequence for an exemplary chimeric protein as per the invention. 9B. 9B. OspC is known from Borrelia strains and could be used in the practice or the invention.
“Those skilled in the art will know that while some embodiments correspond to the primary amino acids sequence of OspC proteins, it is not necessary. An epitope’s amino acid sequence may be modified slightly to make it suitable for the present invention. Certain conservative amino acid substitutions can be made that do not have a detrimental effect on the epitope’s ability to provoke an immune response. These conservative substitutions are easily recognized by those skilled in the art. They include substitutions of positively charged amino acids for other positively charged amino acids, substitutions of negatively charged amino acids for another negatively charged, and substitutions of hydrophobic amino acids for another hydrophobic. The present invention is intended to cover all such substitutions and alterations to the sequence of an epitope in the chimeric proteins of the invention so long as the resulting epitope continues to trigger an appropriate immune response. The chimeric proteins of invention do not have to contain a full-length native epitope, or an epitope-containing area. For the purposes of the invention, it may be preferred to use truncated amino acid sequences that have epitopes. However, the sequence must meet the criteria for epitope. Amino acids sequences that have been so substituted or altered may be called?based on?. These amino acid sequences may be referred to as?based on? oder?derived from? The original wild type sequence or the native sequence. The OspC proteins that the linear epitopes are derived from? The OspC proteins from which the linear epitopes were?derived? These OspC proteins are as found in nature. These OspC natural proteins can alternatively be called native or wildtype proteins.
These changes may be made to the primary sequence for a variety reasons. They can be used to remove or insert a protease site, increase or decrease solubility or promote or discourage inter-molecular interactions like a folding, ionic interaction, salt bridges, etc., which could otherwise hinder the accessibility and presentation of individual epitopes throughout the length of the Chimera. The present invention is intended to cover all such modifications, provided that the resulting amino acids sequence triggers an antibody reaction against the OspC type from where the epitope originated. These substituted sequences should be at least 50% identical to their native counterparts, preferable 60 to 70 or 70 to 80 or 80 to 90% identical, and preferably 95 to about 100% identical.
“In some embodiments, the linear epitopes within the chimeric vaccinegen can be separated by interspersed sequences that are more neutral or less neutral. They do not elicit an immune reaction to Borrelia. These sequences could be found between epitopes in chimeras. They may be present between epitopes of chimeras. If they are, they could serve to isolate epitopes from one another. These sequences could also be an artifact of recombinant processes, e.g. Cloning procedures. These sequences are commonly known as space or linker peptides. Many examples are available to those skilled in the art. Crasto, C. J., and J. A. Feng. 2000. LINKER: A program that generates linker sequences to fusion proteins. Protein Engineering 13(5), 309-312 is a reference which describes unstructured links. Structured linkers (e.g. Structured (e.g.
“In addition to the elements mentioned above, there may also be other elements in the chimeric protein, such as leader sequences and sequences that?tag?” The protein is used to aid in purification and detection. Examples of these elements include histidine tags, detection tag (e.g. S-tag or Flag-tag, other antigenic amino acids sequences, such as known sequences containing T-cell epitopes and protein stabilizing motif sequences, are all possible. Chemical modification of chimeric proteins is possible, e.g. By amidation, sulfurylation, or lipidation, as well as other techniques that are available to those skilled in the art.
“The invention also provides nucleic acids sequences that encode the chimeric protein of the invention. These nucleic acids can be DNA, RNA, or hybrids thereof. The invention also covers vectors that contain or house such coding sequences. Examples of suitable vectors are, but are not limited, plasmids and cosmids as well as viral-based vectors and expression vectors. A preferred embodiment of the vector is a plasmid-expression vector.
“The invention’s chimeric proteins can be made by any method that is suitable, many of which are well-known to those skilled in the art. The proteins can be made chemically or using recombinantDNA technology (e.g. In bacterial cells, in cells (mammalian or yeast), in plants, or by cell-free prokaryotic and eukaryotic based expression systems. The present invention provides compositions that can be used to elicit an immune response. This could be used as a vaccine against Borrelia infection, especially Lyme disease (Lyme Borreliosis). We mean that the antigen is administered to cause the production of antibodies at a specific titer (as described above) or cellular proliferation as measured e.g. By 3H thymidine integration. By ?vaccine? We mean a chimeric protein which triggers an immune response that results in protection against Borrelia challenge. This protects the body from developing symptoms associated with Borrelia infection. Lyme disease symptoms, compared to non-vaccinated people (e.g. as an adjunct to control organisms. The compositions contain one or more substantially purified, recombinant Chimeric Proteins as described herein and a pharmacologically acceptable carrier. The composition may contain a plurality of chimeric protein combinations, which could be different or the same. The composition could be called a “cocktail”. The composition may contain a combination of several chimeras or one type. Those skilled in the art are familiar with the preparation of vaccine compositions. These compositions are usually prepared as liquid solutions or suspensions. However, solid forms like tablets, pills and powders can also be considered. You can also prepare solid forms that are suitable for suspension or solution in liquids before administration. You can also emulsify the preparation. You can mix the active ingredients with excipients that are compatible and pharmaceutically acceptable. Water, saline or dextrose, glucose, ethanol, or combinations thereof, are all acceptable excipients. The composition may also contain small amounts of auxiliary substances, such as pH buffering agents, wetting or emulsifying agent, and the like. An adjuvant may be added to vaccine preparations according to the invention. Examples include Seppic, Quil A and Alhydrogel. You can add flavorings, thickeners, dispersing aids, binders or other ingredients to the composition to make it easier to swallow. Any such ingredients may be added to the composition of the invention in order to make it suitable for administration. There may be variations in the final amount of chimeric proteins contained in the formulations. The formulations generally contain between 0.01 and 99 percent of chimeric protein, weight/volume.
The methods include administering a composition containing a chimeric protein recombinant in a pharmacologically acceptable carrier for a mammal. The present invention allows for the administration of vaccine preparations by many methods well-known to those skilled in the art. These include injections, oral, intramuscular, intranasally, and ingestion of food products containing the chimeric protein. Preferably, the method of administration is intramuscular or subcutaneous. The compositions can also be used in combination with other treatments, such as chemotherapeutic agents or substances that boost immunity.
“The invention provides methods for eliciting an immune response against Borrelia in mammals and to vaccine against Borrelia infection in humans. One embodiment of the mammal is a person. But, anyone skilled in the art will know that there are other mammals for which vaccinations might be beneficial, e.g. The preparations can also be used for veterinary purposes. These include, but are not limited too, companion pets? companion pets? such as dogs and cats, etc. ; animals used for food, work, and recreation, such as cattle, horses and oxen; wild animals that are Borrelia reservoirs (e.g. mice, deer). The invention provides a diagnostic tool and a method to use the diagnostic to identify individuals with antibodies to the chimeric proteins. A biological sample taken from an individual (e.g. A biological sample from an individual (e.g., a human or a deer) is taken and contacted with the chimeric protein of the invention. The presence or absence of a binding reaction is determined using a well-known method. If the result is positive (binding takes place, so antibodies are present), it means that the individual has been infected or exposed to Borrelia. This is why, depending on the purpose of the analysis, chimeras that are specific for OspC types of interest may be created. All OspC types can be included or excluded from the diagnostic chimera.
“Further the diagnostic features of the invention aren’t limited to clinical use or at home, but can also be useful in the laboratory as research tools, e.g. To identify Borrelia spinochetes from ticks and to study the geographic distribution of OspC types.
“The present invention also includes antibodies to the epitopes, and/or to chimeric proteins described herein. These antibodies can be monoclonal, polyclonal, or chimeric and may be created in any way known to those skilled in the art. The preferred embodiment of the invention is that the antibodies are bactericidal, or borreliacidal. Borrelia spirochetes can be exposed to the antibodies and cause death. These antibodies can be used in many ways, including: As detection reagents for diagnosing prior Borrelia exposure, in kits to investigate Borrelia, or to treat Borrelia infections.
The following examples illustrate different embodiments of the invention. However, they should not be construed as limiting.
“EXAMPLES”
“Example 1”
“Demonstration and identification of previously uncharacterized epitopes that define the OspC Antibody Response Specificity”
“Introduction”
Lyme disease can be transmitted to humans by the bite of Ixodes ticks that have been infected with Borrelia burgdorferi (B. garinii), or B. afzelii. OspC (outer surface protein C) is believed to play an important role in the transmission of Lyme disease and in the establishment or early infection in mammals (Grimm, Parl, and Al, 2004; Schwan, et. al., 1995). OspC is a variable, ?22 kDa, surface exposed, plasmid-encoded lipoprotein (Fuchs et al., 1992; Marconi et al., 1993; Sadziene et al., 1993). Three OspC proteins have their crystal structures determined (Eicken and al., 2001; Kumaran and al., 2001). The protein is largely helical and has 5 alpha-helices that are connected by variable loops. It has been suggested that the loops may form ligand binding domains (Eicken and al. 2001; Kumaran and al. 2001). OspC is believed to facilitate the translocation of tick spirochetes into the tick’s midgut. It acts as an adhesin and binds to unknown receptors in the salivary. (Pal, et al., 2004). OspC orthologs have been found in several Borrelia species, raising the possibility of OspC-related proteins playing a similar role in Borrelia species (Marconi and colleagues, 1993; Margolis and colleagues, 1994). OspC expression can be regulated by tick-feeding, and OspC acts as a dominant antigen in early infection of mammals (Alverson, Schwan, 1998; Stevenson, 1995). The RpoN/S regulatory system regulates transcription (Hubner and al., 2001). There are contradicting reports on the exact details of OspC expression in the temporal context of transmission and early infection (Ohnishi, Schwan, 1995).
“OspC displays significant genetic and antigenic diversity” (Theisen, 1995; Theisen, 1993). One hundred and one OspC type phyletic groups have been identified (Seinost, Wang, et. al. 1999). OspC types can be distinguished by their letter designations (A-U). Analysing several hundred OspC sequences found in the databases shows that OspC types may diverge up to 30%, while within one type it is usually less than 6%. Seinost et al. Seinost et. al. (1999) hypothesized that there is a correlation between OspC type A, B, I, and K and invasive diseases in humans. Lagal et al. Lagal et. al. reported that invasive human infections can be correlated with specific ospC variants as determined by single-strand conformation analysis. Alghaferi and his colleagues have recently questioned the strength of this correlation. This area of research is important and very fertile. It concerns the influence of OspC sequence or type on function and host-pathogen interaction. OspC has been studied for Lyme disease vaccine development (Bockenstedt and al. 1997; Gilmore et al., 2003; Gilmore et al., 1999a; Probert et al., 1994; Theisen et al, 1993; Wilske et al, 1996). OspC variation, as well as limited knowledge about the antigenic structure of OspC, have made these efforts more difficult. OspC is capable of protecting against the same strain, but only (Bockenstedt and al. 1997; Gilmore et al., 1999; Gilmore et al., 1999b; Probert and LeFebvre, 1994; Wilske et al, 1996). This suggests that protective epitopes are located in regions of the protein with high sequence variability.
“This study had multiple goals. The first was to further assess the correlation between OspC type invasive infections and OspC type invasive infections. This was done by determining OspC types of invasive and uninvasive isolates from a Maryland patient population. To better understand the type-specific antibody response to OspC was also sought. The antigenic structure of OspC has been defined by identifying epitopes in mice that trigger an antibody response. These data show that OspC types are more common than previously thought (Seinost and al. 1999). We have also identified two previously unknown epitopes, and shown that OspC’s antibody response is type-specific. These analyses have important information that will help us understand the role OspC plays in Lyme disease pathogenesis.
“Experimental Procedures”
“Bacterial Isolates and Cultivation of Infection Serum”
“TABLE 1nBacterial isolates and source information. burgdorferinIsolate source OspC typenB31MI AnLDP56 Blood AnLDP61 Blood AnLDP76 Personal blood AnLDP73 Personal skin AnLDS101 HnLDP84 HnLDP63 HnLDP74 HnLDP121 Human CSF NnLDP120 HnLDP74 HnLDP81 Human skin KnLDS88 KnLDP116 DnDNA Isolation and Computer-Assisted Structur Anas
“TABLE?2\nPolymerase?Chain?Reaction?Primers?employed\nin?this?study.\nSEQ?ID\nPrimer Sequence?a NO:\nospC?20(+)?LIC GACGACGACAAGATTAATAATTCAGG 163\nGAAAGATGGG\nospC?40(+)?LIC GACGACGACAAGATTCCTAATCTTAC 165\nAGAAATAAGTAAAAAAAT\nospC?60(+)?LIC GACGACGACAAGATTAAAGAGGTTGA 165\nAGCGTTGCT\nospC?80(+)?LIC GACGACGACAAGATTAAAATACACCA 166\nAAATAATGGTTTG\nospC?100(+)?LIC GACGACGACAAGATTGGAGCTTATGC 167\nAATATCAACCC\nospC?130(+)?LIC GACGACGACAAGATTTGTTCTGAAAC 168\nATTTACTAATAAATTAAAAG\nospC?136(+)?LIC GACGACGACAAGATTAATAAATTAAA 169\nAGAAAAACACACAGATCTTG\nospC?142(+)?LIC GACGACGACAAGATTCACACAGATCT 170\nTGGTAAAGAAGG\nospC?151(+)?LIC GACGACGACAAGATTACTGATGCTGA 171\nTGCAAAAGAAG\nospC?171(+)?LIC GACGACGACAAGATTGAAGAACTTGG 172\nAAAATTATTTGAATC\nospC?191(+)?LIC GACGACGACAAGATTCTTGCTAATTC 173\nAGTTAAAGAGCTTAC\nospC?130(? )?LIC GACGACAAGCCCGGTTTAACATTTCT 174\nTAGCCGCATCAATTTTTTC\nospC?150(? )?LIC GACGACAAGCCCGGTTTAAACACCTT 175\nCTTTACCAAGATCTGT\nospC?170(? )?LIC GACGACAAGCCCGGTTTAAGCACCTT 176\nTAGTTTTAGTACCATT\nospC?190(? )?LIC GACGACAAGCCCGGTTTACATCTCTT 177\nTAGCTGCTTTTGACA\nospC?200(? )?LIC GACGACAAGCCCGGTTTAGCTTGTAA 178\nTGCTCTTAACTGAATTAGC\nospC?210(? )?LIC GACGACAAGCCCGGTTTAAGGTTTTT 179\nTTGGACTTTCTGC\na LIC tail sequences are underlined\n\nGeneration of Recombinant Proteins.”
“To generate full length OspC and truncations, primers were based on the type a ospC sequence from B. burgdorferi B31MI. (Fraser et al. 1997). These primers have tail sequences that enable annealing into pET32 Ek/LIC vectors (Novagen), as well as ligase-independent cloning (LIC), and expression vectors. All LIC procedures were described previously (Hovis et. al., 2004). Recombinant plasmids from E. coli NovaBlue cells (DE3) were purified using QiaFilter Midi Plasmid Purification Kits (Qiagen). The inserts were then sequenced (MWG Biotech).
“SDS-PAGE & Immunoblot Analyses”
“Proteins were isolated in 12.5% Criterion precast gels (Biorad) using SDS-PAGE. They were then immunoblotted onto PVDF membranes [Millipore] as previously described by Roberts et. al., 2002. S-Protein horseradish oxidase conjugate (Novagen) confirmed the expression of recombinant protein. This detects the Nterminal S-Tag Fusion that is carried in all recombinant protein used in this study. A dilution of 1:1000 was used for the HRP conjugated S-Protein. The dilution of serum from infected mice for immunoblot analysis was 1:1000. The secondary (Pierce), was HRP conjugated goat anti mouse IgG. It was used at 1:10,000 dilution. The general immunoblot procedures were described in Metts et. al. 2003.
“Results”
“ospC Typing Analysis Of Isolates Recovered From Human Lyme Disease Patients In Maryland”
“ospC was amplified successfully from all the isolates analyzed, which were taken from Lyme patients from Maryland. To determine OspC type (FIG), the sequences of each amplified amplicon were determined. Comparative sequence analyses were also performed. 1). There were representatives of many OspC types, including A (n=6) and B (n=1) as well as C (n=1) and D (n=1) respectively. Invasive infections in humans are usually associated with OspC type A, B, C, I, and K, as previously reported by Sinost et. al. (1999). Invasive isolates were those found in blood, organs, or cerebrospinal fluid. Non-invasive isolates, however, were those that were not found elsewhere (Seinost and al., 1999). It was shown that OspC type C, D, or N isolates were found in blood (LDP84, LDP63 and LDP116) and cerebrospinal fluids (LDC83). These isolates are therefore invasive. This observation indicates that OspC type correlations with invasive infections may not be as strong as previously thought.
“Analysis on the Type Specificity and Antibody Response to OspC during Infection in Mice.”
To determine whether the OspC antibody response to infection is type-specific, type A, C, D and H recombinant OspC protein proteins were created. The recombinant proteins of B. burgdorferi were immunoblotted with serum from mice infected (as shown in FIG. 2). The expression of the recombinant proteins was confirmed in E. coli by screening an immunoblot using HRP conjugated S.Protein. This antibody recognizes the S.Tag in the N.terminal fusion. Screened with anti-B. Strong reactivity was only detected with type A protein when the burgdorferi antiserum B31MI (type A OspC), was collected at week 2 of infection. The strong and rapid IgG response to OspC was consistent with previous reports (Theisen, Wilske, and al., 1995). The sera taken at week 8 of infection showed strong cross immunoreactivity with OspC types but a weak reaction to OspC type D and B. LDP116 and LDP73 were OspC type B and D isolates, respectively. The Ab response to OspC was also type-specific. The antibody response to OspC is highly type-specific. This means that in vivo immunodominant epitopes reside within the type-specific domains of the protein.
“Localization and Antibody Response in Mice to OspC Linear Epitopes”
“To identify the epitopes that trigger an antibody response during infection, several OspC fragments were generated. These fragments were then screened with?B. burgdorferi B31MI infected serum (wk 8) (FIG. 3). B31MI is an OspC Type A producing strain. Immunoblotting using the HRP conjugated S-Protein confirmed the expression of the recombinant protein. Immunoblots of OspC fragments were tested with infection serum to identify the linear epitopes. Two domains that contained one or more epitopes in OspC were identified. One was located within the C-terminal portion of the protein between residues 162 and 203 of alpha Helix 5, and the other between residues 136, 150, and loop 5. (henceforth, the alpha 5 and loop 5- epitopes respectively). These epitopes were not previously described in the literature.
“ospC Sequence Analysis and Computer Modeling OspC Structure”
“To determine the location of the loop 5 and alpha5 epitopes spatially on the OspC proteins, coordinates determined using X-ray crystallographic analyses by Eicken et. al. 2001; Kumaran, et. al. 2001 were accessed. Ribbon and space fill models were then generated for monomeric or dimeric forms type A OspC (data is not shown). Models were also created for monomeric forms of the E OspC and type I OspC proteins. These analyses showed that the loop 5 epitope was surface exposed on both monomeric and dimeric types of type I, E, and I OspC protein proteins. X-ray crystallographic analysis revealed that portions of both C-termini and N- were not included in the recombinant proteins. The determined structures show that the N-termini and C-termini are located in close proximity and are proximal the cell membrane.
227 OspC sequences were aligned to assess sequence variation within loop 5 and alpha 5, at the intra-type levels. The analyses showed that the loop 5 and the alpha 5 epitopes were highly variable at inter-type levels, but are remarkably conserved within one type. FIG. FIG. The inter-type conservation of loop 5 was demonstrated by the comparison of 53 type A loop 5 epitopes sequences. Only one or two residues were different in the outlying sequences. Similar observations were made for the alpha5 epitopes. 42 of 43 type A OspC sequences were identical between residues168 and 203. We found fewer alpha5 epitope sequences than expected, as many of the sequences in the databases were incomplete and did not contain sufficient C-terminus.
“Demonstration of the Antibody Response to Loop 5 Epitope Is Not Unique to an Individual Mouse.”
“Considering the low length and intra-type conservation, loop 5 might be a good candidate for the development of an OspC loop5 based vaccinegen. The loop 5 epitope was a common infection site and the antibody response was consistent across the entire animal. Immunoblots of loop 5 containing 130 to 150 fragments were tested with serum from other OspC-producing strains B31MI, LDP56, and 5A4. This epitope was recognized by antibody in all cases (FIG. 5). Loop 5 had a weaker response in LDP56-infected mice 2 and longer exposure revealed that loop 5 was an antigenic agent in this animal. This shows that these epitopes can cause an immune response in multiple animals and is therefore useful for vaccine development.
“Discussion”
“OspC has been clearly shown to be an important contributor to Lyme Disease Pathogenesis (Grimm and al., 2004; Pal and al., 2004; Schwan and al., 1995). It is clear that it plays a significant role in the Lyme disease spirochetes transit from the midgut to salivary gland. (Pal and al., 2004). It is also expressed in a selective manner during early infection and is an immunodominant antibody (Fingerle, 1995; Schwan, 1998; Wilske, 1993). Other researchers have suggested that it plays a critical role in Lyme disease isolate dissemination (Seinost, 1999). This study was designed to determine the possible correlation between OspC type infection and invasive infection. It also determined if OspC’s antibody response is type-specific. The antigenic structure of OspC was further defined by locating the linear epitopes present during infection.
“Sequence analysis of OspC has delineated 21 distinct OspC kinds (Seinost and al. 1999). It is believed that only four (types A and B, I, and K) are associated to invasive infections in people (Seinost and al. 1999). Alghaferi and colleagues (2005) have questioned this supposed correlation. This was further addressed by determining the OspC type and non-invasive Lyme diseases isolates from Maryland patients. The full length of the ospC gene was sequenced, PCR amplified and comparative sequence analyses were conducted to accomplish this. These analyses showed that OspC types involved in invasive human infection in this patient population also included types C, D and N. However, none of the invasive strains found in Maryland patients had a type I OspC. Similarly, Alghaferi et al. Alghaferi and colleagues, 2005 also failed to detect OspC-producing strains of type I. These two studies collectively identified 18 invasive strains in Baltimore. The breakdown is as follows: A, B, C, D, H, N, 7 and C, n=5 respectively. In this area, OspC types A and N are the most common. These data support the notion that only 4 OspC types can cause invasive infections in humans. To further evaluate the validity of OspC type?invasive infections correlation and determine if there are differences in the prevalences of OspC types within defined geographic regions, additional analyses will be needed.
“The combination of OspC vaccination and the identification of different OspC types raises the possibility that an antibody response may be specific to a particular type. This hypothesis is supported in part by the fact OspC vaccination has been shown to protect against the same strain (Bockenstadt and al., 1997; Gilmore and al., 1999a; Probert & LeFebvre 1994). The type specificity of OspC’s antibody response during infection was not directly evaluated until this report. This was addressed by screening full-length recombinant OspC protein types A, B and C with infection serum in mice expressing known OspC type. Because it allows for the evaluation of antibody responses to epitopes specific to the bacterium in-vivo, the importance of using infection serum is crucial. These analyses showed that despite strong sequence conservation in the N- and C-terminal domains OspC, the type specific antibody response to OspC types was evident. For example, serum from mice infected with type A or D strains was immunoreactive in a type specific manner with little or no cross-immunoreactivity with other OspC types. The data above indicate that although the antibody response to 21 OspC types wasn’t analyzed, they aren’t immunodominant. Furthermore, the linear epitopes presented by OspC during infection were found within the variable domains of the protein (i.e. type specific domains).
“Only a handful of studies have been published that attempted to identify or localize the epitopes for OspC. It has been possible to identify both conformational and linear epitopes. Gilmore and Mbow showed that the monoclonal antibody, B5, is not bound by independent N terminal deletions. They can be as short as 6 residues, or as long as 13 residues. This revealed that the monoclonal antibody B5 recognizes a conformationally-defined epitope (Gilmore and co-authors, 1999b). It was not possible to identify the exact residues that make up this antibody recognition site within this epitope. Contrary to the monoclonal antibody, B5, the analysis of the polyclonal response to native OspC showed that OspC was not recognized by IgG during infection even though the C-terminal 10 residues were removed. The difference in results may be due to the emphasis on monoclonal and polyclonal antibodies. These data, while not denying the existence of conformational epitopes do show that OspC also contains linear epitopes. In an earlier study, Mathieson et al. Mathieson et. al., 1998 also reported on OspC’s linear epitope. The linear epitope in OspC’s C-terminal 7 residues was identified by IgM from serum taken from European neuroborreliosis sufferers. Although IgM binding was not evaluated in this report, OspC’s deletion of the 10 C-terminal residues did not eliminate IgG binding. The protein’s epitopes that are recognized and induced by infection appear to be located at multiple sites. This does not mean that an epitope at the C-terminal of the protein is absent or not recognized by IgG elicited during infected. It just means that there may be additional epitopes elsewhere in OspC.
“Immunoblot analysis on shorter OspC fragments enabled for more precise localizations of OspC epitopes. Two regions were identified as the antigenic regions for OspC. The one covers residues 136 to 150, while the other covers residues from 168 up to 210. Structural models based on coordinates from Xray diffraction analyses place residues 136 to 150 largely within a loop called loop 5. (Kumaran et. al., 2001). Loop 5 is visible in both mono- and dimeric OspC models and is located within an obvious bend. Although it has been shown that OspC can form dimers in vitro, it is not known if native OspC can make larger oligomers or dimers. A significant buried interface of OspC that is greater than 30% indicates a dimeric model. This buried interface is thought to indicate a tight interaction of monomers. The OspC dimer’s loop 5 contains residues that are thought to be part of a conformationally defined ligand binding pouch. This pocket may have biological significance. The charged pocket is lined with amino acids that contain carbonyl groups, such as glutamate or aspartate residues. Three OspC proteins types A, I and E have their crystal structures determined by Kumaran et. al. 2001. The solvent structures of the putative binding pocket in all three OspC proteins are well conserved. Loop 5 is accessible to antibody in the infection serum, supporting the hypothesis that this domain might be surface exposed and available for ligand binding. The sequence of the domain is highly variable at inter-type levels despite strong inter-type structural conservation for loop 5 and the putative binding pocket. The sequence of alpha 5 domain residues 168-210 is variable at the intertype level, with the exception of 20 residues that are highly conserved. OspC sequences were aligned to determine if there is enough conservation at the intra-type level for the construction a chimeric OspC vaccination that consists of a series epitopes specific to each type. A dendogram was then constructed. These analyses revealed that the OspC type for 227 sequences was determined (data not shown). Both the loop 5 (alpha 5) and the alpha 5 epitopes of type A OspC proteins were well conserved at intra-type levels. The loop 5 epitopes of type OspC OspC proteins were found to be identical in 54 sequences, while the alpha5 epitope was conserved within 42 of 43 sequences. These domains were also conserved in other OspC types, with types C through M, N, and O showing absolute intra-type conservation within their loop 5 and alpha5 epitopes.
“This study shows that OspC diversity is greater among invasive isolates than was previously thought. This study also shows that OspC antibody responses in mice are largely type-specific and are defined by previously unknown loop 5 and alpha5 epitopes. The data presented here and earlier studies clearly show that OspC proteins do not provide protection against all strains. (Bockenstedt, 1997). A possible vaccine approach is to use the epitopes in this report for the development of a recombinant OspC vaccinegen. If they are consistently antigenic in humans, the loop 5 epitope (or a combination thereof) may be most promising. These epitopes have a relatively short length, are linear and highly conserved at intra-type levels. It should be technically possible to create a loop 5-alpha-5 chimeric vaccinegen that provides protection against Lyme disease isolates of high severity.
“Example 2”
“Analysis and Evaluation of Antibody Response in Humans To the Type A OspC Loop 5 Domain”
“Outer surface protein (OspC), a 22-kDa antigen in Lyme disease spirochetes, is produced upon tick feeding and early stages of infection. (Schwan et Al, 1995). OspC produces strong antibodies during natural infection. However, this response doesn’t lead to bacterial elimination because OspC production ceases shortly after infection has been established (Schwan and al. 1995). OspC has been identified as a key virulence factor, and is a candidate for Lyme disease vaccine development. The heterogeneity of OspC among strains has hampered efforts to create an OspC-based vaccine (Theisen and Al, 1993; Wilske, et. al, 1996; Wilske, et. al, 1993). Although vaccination with OspC elicits a highly protective response, most studies have reported only strain-specific protection (Bockenstedt et al, 1997; Gilmore et al, 1996; Mbow et al, n 1999; Probert et al, 1997; Rousselle et al, 1998; Scheiblhofer et al., 2003). Recent studies have given us important insight into the antigenic structure and basis of OspC’s strain-specific protection. There are 21 OspC types (designated A through U by Lagal et. al. 2003; Seinost and al. 1999; Wang et. al. 1999). It was shown that early infection by Borrelia burgdorferi clonal populations in mice is OspC-specific (see Example 1). This indicates that OspC type-specific domains are where the epitopes most prevalent during early infection. Although earlier studies indicated that only 4 OspC types were associated with invasive infections (Seinost and al. 1999), more recent research has shown that OspC isolates can cause invasive infections (Alghaferi, et. al. 2005; Example 1). Type A OspC seems to dominate in strains that can cause invasive infections in humans. The loop 5 domain was the epitope that provokes the most response in mice according to epitope mapping analyses. (See Example 1). The loop 5 domain is highly variable between types, but it is conserved within a specific type’s sequences (see Example 1). We refine the epitope’s location, show its exposure to intact bacteria and demonstrate that it produces bactericidal antibodies.
“To better define the loop 5 domain residues that are recognized as infection-induced antibodies, PepSpot arrays have been screened with sera from patients 8 to 44 and serum from mice infected by a clonal population from the type A OspC producing strain B31MI (see example 1). PepSpot arrays contained 12- to 13-residue, overlapping peptides (two amino-acid step), that covered the loop 5 domain (type A OspC) and were spotted onto Whatman 50 cellulose membrane (150 nmol/cm2 JPT Peptide Technologies GmbH Berlin, Germany). After blocking the membranes with 5% nonfat dry milk in Tris buffered saline-0.5%Tween 20, they were washed and screened using mouse and human serum samples (1:1,000 and 1:1400 respectively). Antibody binding was detected using species-specific anti IgG antiserum. Although the exact residues of the immunoreactive domain were slightly different in mice and humans the main epitopes were located within residues 130-146 (FIG. 7). This region includes the C-terminal area of alpha helix 3, and the N-terminal section of loop 5.
“Several reports have provided strong support for the development Lyme disease vaccines (reviewed by Hanson and Edelman 2004). Currently, however, there is no commercially available vaccine. Baxter attempted to create a vaccine cocktail that contained 14 full-length rOspC proteins in an attempt to develop a broad Lyme disease vaccine (Hanson & Edelman, 2004). The cocktail was rejected as being too reactigenic. Reactigenicity could have been due to the high amount of protein required to provoke a sufficient response against the OspC types of OspC proteins in the cocktail. Cocktail vaccines that contain multiple full-length proteins have the potential to misdirect the antibody response to nonprotective, conserved epitopes. This problem could be overcome by creating a chimeric, human-derived r-vaccinogen that contains the naturally occurring immunodominant linear epitopes from each dominant OspC type. This concept was developed in the development of malarial vaccines by using epitopes derived from different proteins at different stages (Hanson & Edelman, 2004). This same concept was used in the creation of a hexavalent M-protein vaccine for group A streptococci (Dale 1999); Fan et. al., 2005, Horvath et. al., 2005, Kotloff, McNeil, 2005, Wang et. al., 2005). It may be possible to create an OspC vaccine that is r-polyvalent and chimeric with new information. This vaccine could include the newly identified loop 5 domain.
“Example 3”
“Development an OspC – Based Tetravalent, Recombinant and Chimeric Vacinogen”
Lyme disease is the most prevalent arthropod-borne disease in North America, Europe and North America. There is currently no vaccine that can be used to treat Lyme disease in humans. Outer surface proteinC (OspC), which has attractive antigenic and expression properties, has been hampered from being used as a vaccine. 21 OspC types or phyletic groups have been identified by sequence analysis. (designated A-U). This study describes the mapping of OspC type B, K, and D linear epitopes during human and murine infections and their exploitation (alongside the previously identified OspC type A OspC line epitopes) for the development of a recombinant tetravalent, Chimeric Vaccininogen. The construct was highly immunogenic in mice, and the induced antibodies were labeled with in vitro cultivated Spirochetes. Importantly, vaccination produced complement-dependent bactericidal antibody against each OspC type that was incorporated into the construct. These results indicate that a recombinant, modified protein can be made to produce a protective and effective OspC-based Lyme vaccine.
“Materials & Methods”
“Borrelia burgdorferi Cultivation and Isolates”
“Ligase Independent Cloning of OspC Proteins and Production of Recombinant (r) OspC Proteins.”
“TABLE?3\nPCR?primers?used?in?the?generation?of?various?OspC?type?fragments.\nPrimer Sequence Description SEQ?ID?NO:\nospC20(+)LIC GACGACGACAAGATTAAT Amplifies?OspC 180\nAATTCAGGGAAAGATGGG from?aa?20?and\nadds?LIC?tail\nospC210(+)LIC GACGACAAGCCCGGTTTA Amplifies?OspC?up 181\nAGGTTTTTTTGGACTTTC to?aa?210?and?adds\nTGC LIC?tail\nOCB110LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?B 182\nTTGTGTTATTAAGGTTGA up?to?aa?110?and\nTATTG adds?LIC?tail\nOCB131LIC(+) GACGACGACAAGATCTTC Amplifies?type?B 183\nTGAAGAGTTTAGTACTAA from?aa?131?and\nACTAAAA adds?LIC?tail\nOCB140LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?B 184\nTTTTAGTTTAGTACTAAA up?to?aa?140?and\nCTCTTCAG adds?LIC?tail\nOCB140LIC(+) GACGACGACAAGATAGAT Amplifies?type?B 185\nAATCATGCACAGCTTGGT from?aa?140?and\nATACAG adds?LIC?tail\nOCB148LIC(+) GACGACGACAAGATTATA Amplifies?type?B 186\nCAGGGCGTTACTGATGAA from?aa?148?and\nAATGC adds?LIC?tail\nOCB153LIC(+) GACGACGACAAGATTGAA Amplifies?type?B 187\nAATGCAAAAAAAGCTATT from?aa?153?and\nTTAAAA adds?LIC?tail\nOCB155LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?B 188\nTGCATTTTCATCAGTAAC up?to?aa?155?and\nGCCCTG adds?LIC?tail\nOCB164LIC(+) GACGACGACAAGATTGCA Amplifies?type?B 189\nGCGGGTAAAGATAAGGGC from?aa?164?and\nGTTGAAG adds?LIC?tail\nOCB169LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?B 190\nCTTATCTTTACCCGCTGC up?to?aa?169?and\nadds?LIC?tail\nOCB175LIC(+) GACGACGACAAGATTGAA Amplifies?type?B 191\nAAGTTGTCCGGATCATTA from?aa?175?and\nGAAAGC adds?LIC?tail\nOCB180LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?B 192\nTGATCCGGACAACTTTTC up?to?aa?180?and\nAAGTTCTTC adds?LIC?tail\nOCB181LIC(+) GACGACGACAAGATCTTA Amplifies?type?B 193\nGAAAGCTTATCGAAAGCA from?aa?181?and\nGCTAAAGAG adds?LIC?tail\nOCB185LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?B 194\nTGATTAAGCTTTCTAATG up?to?aa?185?and\nATCCGGAC adds?LIC?tail\nOCB190LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?B 195\nCTCTTTAGCTGCTTTTGA up?to?aa?190?and\nTAAGCTTC adds?LIC?tail\nOCB200LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?B 196\nTGTAAGCTCTTTAACTGA and?K?up?to?aa?200\nATTAGCAAG and?adds?LIC?tail\nOCB49LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?B 197\nAATTTTTTTACTTATTTC and?D?up?to?aa?49\nTGTAAG and?adds?LIC?tail\nOCB80LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?B 198\nTTTTTTACCAATAGCTTT up?to?aa?80?and\nAGCAAGCTC adds?LIC?tail\nOCD112LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?D 199\nTAATTTTTCTGTTATTAG up?to?aa?112?and\nAGCTG adds?LIC?tail\nOCD130LIC(+) GACGACGACAAGATTAAA Amplifies?type?D 200\nTGTTCTGAAAGCTTTAC from?aa?130?and\nadds?LIC?tail\nOCD135LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?D 201\nAAAGCTTTCAGAAACATT up?to?aa?135?and\nTCTTAGC adds?LIC?tail\nOCD135LIC(+) GACGACGACAAGATTACT Amplifies?type?D 202\nAAAAAACTATCAGATAAT from?aa?135?and\nCAAGCAG adds?LIC?tail\nOCD144LIC(+) GACGACGACAAGATTGAG Amplifies?type?D 203\nCTTGGTATAGAGAATGCT from?aa?144?and\nACTGATG adds?LIC?tail\nOCD151LIC(+) GACGACGACAAGATTGCT Amplifies?type?D 204\nACTGATGATAATGCAAAA from?aa?151?and\nAAGGC adds?LIC?tail\nOCD155LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?D 205\nATTATCATCAGTAGCATT up?to?aa?155?and\nCTCTATACC adds?LIC?tail\nOCD166LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?D 206\nAGCATTATGTGTTTTTAA up?to?aa?166?and\nAATAGCC adds?LIC?tail\nOCD167LIC(+) GACGACGACAAGATTAAA Amplifies?type?D 207\nGACAAGGGTGCTGAAGAA from?aa?167?and\nCTTG adds?LIC?tail\nOCD180LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?D 208\nTGATTCAGATAACTTTAC up?to?aa?180?and\nAAGTTC adds?LIC?tail\nOCD180LIC(+) GACGACGACAAGATTTCA Amplifies?type?D 209\nGTAGCAGGCTTATTAAAA from?aa?180?and\nGCAGCTC adds?LIC?tail\nOCD195LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?D 210\nTGAATTAGCCAGTATGGC up?to?aa?195?and\nTTGAGCTGC adds?LIC?tail\nOCD195LIC(+) GACGACGACAAGATTTCA Amplifies?type?D 211\nGTTAAAGAGCTTACAAGT from?aa?195?and\nCCTG adds?LIC?tail\nOCD80LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?D 212\nATCTATTTTTTTACCAAT up?to?aa?80?and\nA adds?LIC?tail\nOCK110LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?K 213\nTTGTGTTATTAGTTTTGA up?to?aa?110?and\nTATTG adds?LIC?tail\nOCK130LIC(+) GATGACGACGACAAGATT Amplifies?type?K 214\nAAATGTTCTGAAGATTTT from?aa?130?and\nAC adds?LIC?tail\nOCK135LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?K 215\nAAAATCTTCAGAACATTT up?to?aa?135?and\nCTTAGC adds?LIC?tail\nOCK148LIC(+) GATGACGACGACAAGATA Amplifies?type?K 216\nATTGAAAATGTTACTGAT from?aa?148?and\nGAGAATGC adds?LIC?tail\nOCK150LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?K 217\nATTTTCAATTCCAAGTTG up?to?aa?150?and\nCGCATGTTC adds?LIC?tail\nOCK160LIC(+) GATGACGACGACAAGATT Amplifies?type?K 218\nATTTTAATAACAGATGCA from?aa?160?and\nGCTAAAG adds?LIC?tail\nOCK166LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?K 219\nAGCTGCATCTGTTATTAA up?to?aa?166?and\nAATAGC adds?LIC?tail\nOCK175LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?K 220\nTTCAAGCTCTGCAGCGCC up?to?aa?175?and\nCTTATC adds?LIC?tail\nOCK180LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?K 221\nTGCTTTAAATAGCTTTTC up?to?aa?180?and\nAAGCTCTGC adds?LIC?tail\nOCK180LIC(+) GATGACGACGACAAGATT Amplifies?type?K 222\nGCAGTAGAAACTTGGCAA from?aa?180?and\nAAGCAGC adds?LIC?tail\nOCK190LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?K 223\nCTCTTTAGCTGCTTTTGC up?to?aa?190?and\nCTTGTTTTC adds?LIC?tail\nOCK191LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?K 224\nCATCTCTTTAGCTGCTTT up?to?aa?191?and\nTGCCAAG adds?LIC?tail\nOCK8OLIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?K 225\nTTTTTTACCAATAGCTTT up?to?aa?80?and\nAGTAGC adds?LIC?tail\nLIC tails are in bold.\n\nImmunoblot Analyses: Epitope Mapping of OspC Types B, D, and K.”
“To map epitopes that are relevant during infection, C3H/HeJ mouse were infected by 104 spirochetes from clonal populations OspC types K, D. Blood was collected at weeks 2, 4, 6, 8, 8 and 12, and tail bleeding. These sera were used for screening OspC proteins and other truncations, as shown in Example 1. The r-proteins were subjected a SDS-PAGE analysis, transferred to PVDF and screened using a 1:1000 dilution (collected at week 6). The r-proteins were also screened using serum (1:400), from patients who had been infected by a B.burgdorferi strain that carries OspC type B, K or D. (kindly provided Dr. Allen Steere). The appropriate IgG specific, horseradish-peroxidase-conjugated secondary antibody was used. The results were visualized using chemiluminescence.
“Construction of a Tetravalent Chimeric Viral Vaccinogen”
“TABLE?4\nPCR?primers?used?in?the?generation?of?the?ABKD?chimeric?vaccinogen.\nPrimer Sequence Description SEQ?ID?NO:\nOCAL5LIC(+) GACGACGACAAGATTTCTG Amplifies?type?A 226\nAAACATTTACTAATAAATTA from?aa?131?and\nAAAGAAAAAC adds?LIC?tail\nOCAL5L1(?) TAACATACCCATGCTACCTTC Amplifies?type?A?up 227\nTTTACCAAGATCTGTGTG to?aa?149?and?adds\nlinker?1? (GSMGML;\nSEQ?ID?76)\nOCBH5L1(+) GGTAGCATGGGTATGTTAAA Amplifies?type?B 228\nAGCAAATGCAGCGGG from?aa?160?and\nadds?linker?1\n(GSMGML;\nSEQ?ID?76)\nOCBH5L2(?) TAAGTTACCGTTTGTGCTTGT Amplifies?type?B?up 229\nAAGCTCTTTAACTGAATTAG to?aa?201?and?adds\nlinker?2? (STNGNL;\nSEQ?ID?77)\nOCKH5L2(+) AGCACAAACGGTAACTTAAT Amplifies?type?K 230\nAACAGATGCAGCTAAAGATA from?aa?161?and\nAGG adds?linker?2\n(STNGNL;\nSEQ?ID?77)\nOCKH5L3(?) TAAAACGCTCATGCTACTTGT Amplifies?type?K?up 231\nAAGCTCTTTAACTGAATTAGC to?aa?201?and?adds\nlinker?3? (SSMSVL;\nSEQ?ID?78)\nOCDH5L3(+) AGTAGCATGAGCGTTTTAAA Amplifies?type?D 232\nAACACATAATGCTAAAGACA from?aa?161?and\nAG adds?linker?3\n(SSMSVL;\nSEQ?ID?78)\nOCDH5LIC(?) GAGGAGAAGCCCGGTTTAA Amplifies?type?D?up 233\nCTTGTAAGCTCTTTAACTGAA to?aa?201?and?adds\nTTAG an?LIC?tail\nLIC tails are in bold, and linker sequences are underlined.\n\nImmunization of Mice with the Tetravalent ABKD Chimeric Vaccinogen.”
Twelve six-week old male C3H/HeJ strain, male mice were given 50 g of the chimeric vaccinegen in a 1:1 mixture with complete Freund’s adjuvant. The total dose of the vaccinogen was 200 mL. It was administered intraperitoneally and subcutaneously in two separate depots. Three control mice received sham vaccinations with PBS in CFA. The mice were given 50 g of Freund’s incomplete adjuvant protein at weeks 2 and 4. Sham-immunized mice were given PBS as adjuvant. Before the first injection, all mice were bled with tail nick. This was repeated at week 6.
“Assessment on the Immunogenicity for the ABKD Chimeric Vaccinogen.”
“Immunoglobulin Isotype Profiling the Anti-ABKD Antibody Reaction.”
“The isotype profile for the anti-ABKD antibody reaction was determined by coating duplicate ELISA plates using 100 ng of the chimeric construct. After washing the plates, they were blocked according to the above procedure. Anti-ABKD antibodies from 12 vaccinated mice were collected in duplicate and analysed (100?L, 1:10000; 1 hr). Bound vaccinogen specific Ig was detected after incubation (1 hr) with biotinylated secondary antibody (1 hr). Bound biotinylated antibodies were detected using HRP-conjugated streptavidin (30 minutes) and the chromogenic substrate ABTS. All incubations took place at room temperature.
“Indirect Immunofluorescence assays (IFA)”
Summary for “Polyvalent Chimeric OspC vaccinegen and diagnostic antibody”
“1. “1.
“The invention generally refers to a vaccine or diagnostic for Lyme disease. The invention provides a chimeric polyvalent protein recombinant to Lyme’s disease. It includes immunodominant epitopes from loop 5 and/or the alpha helix 5, regions/domains of outer protein C (OspC), types that are associated with mammalian infections.
“2. “2.
Lyme disease is the most widespread arthropod-borne disease in North America, Europe and North America. Borrelia burgdorferi (B. garinii), and B. afzelii (B. afzelii) are the spirochetes that cause it. Transmission to mammals is through the bites of infected Ixodes Ticks [Burgdorfer and al. 1982, Benach and al. 1983]. Lyme disease is associated with significant morbidity. There are places in Europe and the United States where as high as 3% of the population can be infected each year [Fahrer and al., 1991]. Lyme disease is a multi-systemic inflammatory disorder that can cause headaches, low-grade fever, erythema and myalgia. Late-stage clinical manifestations may be severe and include arthritis [Steere and Al., 1997a; Eiffert and al. 1998; Steere and al. 2004], carditis (Asch et.l. 1994; Nagi and al. 1996 Barthold and al. 1991] and neurological complications (Nachman, Pontrelli 2003; Coyle & Schutzer 2002]. Lyme disease can also have significant socio-economic consequences. This is manifested in a reduction in outdoor recreational and other social activities as a result of tick exposure.
“Pharmacoeconomic studies show that there is a clear need for Lyme disease vaccines, especially in areas where the annual risk of contracting the disease exceeds 1% [Meltzer and al. 1999; Shadick and al. 2001]. A vaccine is currently not commercially available. OspA-based LYMErix was the first vaccine for Lyme disease. However, due to a decline in sales, the company pulled it from the market in 2002. Concerns, whether real or perceived, about possible adverse effects, including a chronic inflammatory joint, could explain the decline in sales [Kalish et. al., 1993]. New OspA based vaccines are being developed to address this potential problem [Koide and al. 2005; Willett and al. 2004]. However, there remain questions about the viability or efficacy of an OspA vaccine. The frequency of boosters necessary to sustain long-term protection is a concern. OspA, which is found in tick midgut, is quickly down-regulated by tick feeding and is not expressed on mammals [Gilmore, et. al. 2001; Schwan, et. al. 1995]. OspA-based vaccines work by targeting spirochetes in the tick to prevent their transmission [de Silva and al., 1999]. Effective protection depends on the presence of high levels of anti-OspA antibodies in the circulating bloodstream. This is because transmission can occur within 48 hours after tick feeding. Antigens that are expressed at high levels in early infection can avoid the inherent problems with OspA-based vaccinations. They also elicit bactericidal antibodies.
Lyme disease vaccine development has given OspC a lot of attention. It is a surface-exposed lipoprotein of 22 kDa [Fuchs and al. 1992]. It is encoded on a 26kb circular DNA that is universal between isolates from the B.burgdorferi sensu Lato complex [Marconi, 1993; Sadziene, etg., 1993]. It is expressed by ticks and maintained in early mammalian infection (Schwan, 2004). Anti-OspC antibodies have been demonstrated to protect against infection, but only against strains expressing OspC that is closely related in sequence to the vaccinogen [Gilmore et al., 1996; Bockenstedt et al., 1997; Gilmore and Mbow, 1999; Mathiesen et al., 1998; Scheiblhofer et al., 2003; Jobe et al., 2003; Rousselle et al., 1998; Wallich et al., 2001; Mbow et al., 1999; Probert et al., 1997; Brown et al., 2005; Probert and LeFebvre 1994]. Analysis of OspC sequences has revealed?21 OspC clusters, or types, that can be distinguished by letters (A-U) [Seinost and Wang, 1999; Wang, et. al. 1999]. Although sequence variation within a cluster can be less than 2%, it can reach as high as 22% between OspC types [Wang and Al., 1999; Theisen and Al., 1995; Brisson & Dykhuizen 2004]. This inter-type variation in epitopes is most likely what explains the limited protection provided by vaccination with one OspC type.
“U.S. Pat. No. 6,248,562 (Jun. 6,248,562 (Jun. The chimeric polypeptides in the chimeric protein are derived from any Borrelia strain. They include OspA and OspB and OspC and OspD. These chimeric proteins are useful as immunodiagnostic reagents or vaccine immunogens for Borrelia infection. OspC proteins do not contain loop 5 or alpha 5 epitopes.
“U.S. Pat. Nos. Nos. 6,872,550 (Mar. 6,872,550 and 6,486,130 (Mar. These patents do not mention the characterization loop 5 or alpha 5 epitopes.
“U.S. Pat. No. 7,008,625 (Mar. 7, 2006) to Dattwyler et al. This paper discloses antigenic polypeptides from a variety Borrelia strains, and/or proteins within one protein. The chimeric Borrelia protein is made up of fragments of polypeptides from the outer surface proteins OspA, OspC. These proteins are effective against Lyme Borreliosis and can also be used as immunodiagnostic reagents. The characterization of loop 5 or alpha 5 epitopes is not mentioned.
“The publication ‘Recombinant Chimeric Borrelia proteins for diagnosis of Lyme Disease? (Maria J. C. Gomes-Solecki et al. 2000. J. Clin. Microbiol. 38: 2530-2535). This patent is closely related to the above-mentioned patents. Each chimera contained portions of OspA, OspB and OspC which are key antigenic proteins for Borrelia burgdorferi. Although the paper is primarily focused on diagnosis, it also discusses applications for vaccinogens. Although the authors acknowledge that it is possible to create better chimeras by further studying the genetic variability of important epitopes, they do not mention OspC’s loop 5 or alpha 5 epitopes.
“The prior art has so far failed to provide a vaccine that provides broad protection against multiple OspC types in order to treat Lyme disease prevention and/or treatment.”
“The invention provides a chimeric, polyvalent recombinant protein that can be used as a diagnostic and vaccine for Lyme disease. This invention was partly based on the identification and characterisation of novel protective epitopes from multiple OspC types. Each of these is associated with mammalian (e.g. Lyme disease in humans. These epitopes were identified and made it possible to create a chimeric protein (or proteins) that contains a variety of OspC types. The chimeric recombinant proteins can be used to provide broad protection against OspC-type Borrelia strains. They are also associated with mammalian Lyme diseases. The chimeric protein can also be used as a diagnostic tool for identifying individuals with antibodies to the epitopes and to determine whether an individual has been infected or exposed to Lyme disease causative agent. The epitopes may be B-cell epitopes or immunodominant epitopes in some embodiments.
This invention aims to provide a chimeric protein that contains epitopes from the loop 5 region or the alpha helix5 region of one or more outer surface protein types (OspC). One embodiment of the OspC type selections are Smar, H13 and PFiM. SL10 and PMit. HT22 and HT25. VS461, DK15 and HT25. Another embodiment has an OspC type E, N and I, C, A and B. Yet another embodiment has a primary amino acids sequence as described in SEQ ID No: 75 or SEQID NO: 249. Some OspC types may be associated with invasive Borrelia infections.
“The invention also provides a means to elicit an immune response against Borrelia in an individual who is in need of it. The method involves administering to an individual a chimeric protein containing epitopes from the loop 5 region or the alpha helix5 region of one or more outer surface proteinC (OspC). One embodiment of the invention includes OspCs that are chosen from the following: Smar, H13. PFiM. SL10. PMit. PKi. PKi. HT22. HT25. VS461. HT25. HT25. Lastly, the method comprises the step of administering to the individual a chimeric protein comprising epitopes starting in loop 5 region or alpha helix 5 region of two or more outer surface protein C (OspC): 259. Some embodiments of the OspC types can be associated with invasive Borrelia infections.
The invention also provides a method to determine whether an individual has been infected or exposed to Borrelia. This method involves the following steps: 1) collecting a biological sample from an individual; 2) subjecting the biological sample to at most one recombinant protein chimeric, wherein at least one protein contains epitopes from loop 5, alpha helix 5, or both of the two or more outer protein C (OspC), types; and 3) determining if antibodies in the biological sample bind to at least one of the chimeric proteins. The detection of antibody binding indicates that the individual has been exposed to Borrelia a prior to or was to Borrelia a a a a a a a a chimeric a recombinant a a a a a a a a a a a a a a a sesq ID NO: 75 or SEQ ID NO: 249. One embodiment of this invention includes OspCs that are selected from the following: Smar, PMit and PKi; HT22 and PT25; 2) exposing the biological sample to at least one recombinant chimeric protein, wherein the at least one chimeric protein contains epitopes in loop 5 region or alpha helix 5 regions, or both of these outer surface protein C (OspC) types; and 3) determining whether antibodies in the biological sample bind to the primary amino acids as shown in SEQ ID: 75 and SEQ ID: 249. Some embodiments of the invention associate OspC types with invasive Borrelia infections.
The invention also provides antibodies to a Chimeric Recombinant Protein that includes epitopes in loop 5 or alpha-helix 5 regions of one or more outer surface proteins C (OspC). One embodiment of the invention includes OspCs that are chosen from the following: Smar, PMit. PLi. H13. PFiM. SL10. PMit. PKi. PHbes. HT22. HT25. VS461. HT25. Likewise, epitopes in the loop 5 region or alpha helix 5 region of two or more outer surface protein C (OspC) types. Another embodiment has a primary sequence of amino acids as described in SEQ ID: 2499. Some embodiments of the OspC types may be associated with invasive Borrelia infections. Monoclonal and polyclonal antibodies are possible. One embodiment of the antibody is bactericidal against Borrelia spirochetes.
“The invention also provides an immunogenic cocktail containing chimeric-recombinant proteins. Every chimeric recombinant proteins in the cocktail contains epitopes from loop 5, or alpha-helix 5 regions, or both of two or more outer protein C (OspC).
“The present invention was based on the identification of protective epitopes that are type-specific and specific to OspC types. These epitopes have been associated with Lyme disease infection. Two domains (regions), in OspC’s carboxyl-terminal portion, contain the novel epitopes. None of these domains were previously considered highly immunogenic. The first domain was referred to as the?alpha 5 region/domain. or ?alpha 5 region/domain? or?helix5 region/domain Herein), is located between residues 160-200. It contains secondary structural elements, including loop 6, alphahelix 5, and an unstructured Cterminal domain (Kumaran and al., 2001). The second domain (or loop 5 region/domain) is located between residues 160 and 200. Herein, the second domain (?loop 5 region/domain) is located between residues 131-39 and 159. It contains secondary structural elements such as a portion alpha helix 3, loop 5, and alpha-helix 4, (Kumaran and al. 2001). Each region contains at least one epitope which may be used to practice the present invention. These epitopes, also known as antigenic peptides and polypeptides within these regions, can be used in practice of the invention. They may be used alone or in combination with other epitopes in an chimeric immunegen. The epitopes in some embodiments are immunodominant epitopes. The epitopes are typically B-cell epitopes. However, T-cell epitopes can be included.
“The discovery of novel epitopes and the mapping of epitopes with different OspC type has allowed for the creation of multivalent chimeric protein that contains a variety of linear, type-specific immunodominant epitopes of multiple OspC kinds. The multivalent (polyvalent), recombinant, chimeric protein provides broad protection against infection by Borrelia spirochetes. It is able to be used as a vaccine. Borrelia spirochetes that are highly infectious. The chimeric proteins can also be used as diagnostic tools to determine whether an individual is infected with Lyme disease causative agents.
“The following definitions will help you understand the invention.
Antigen is a term that has been used to denote an entity that is bound to an antibody and the entity that causes the production of that antibody. The meaning of antigen is now limited to the entity bound by antibodies. However, the term ‘immunogen’ is more commonly used. The entity that induces antibody formation is called ‘immunogen’. If an entity is both immunogenic or antigenic, it will be referred to as such according to its intended utility. The terms “antigen”, “immunogen?” are used interchangeably. The terms?antigen?,?immunogen? and?epitope may be interchangeably used herein. The terms?epitope? and?antigenic determinant? may be interchangeable herein. The term is interchangeable with ?antigenic determinant?.\nImmunodominant epitope: The epitope on a molecule that induces the dominant, or most intense, immune response.\nLinear epitope: An epitope comprising a single, non-interrupted, contiguous chain of amino acids joined together by peptide bonds to form a peptide or polypeptide. This epitope is described by its primary structure. the linear sequence of amino acids in the chain.\nConformational epitope: an epitope comprised of at least some amino acids that are not part of an uninterrupted, linear sequence of amino acids, but which are brought into proximity to other residues in the epitope by secondary, tertiary and/or quaternary interactions of the protein. These residues can be far away from the primary sequence of amino acids in the epitope, but they may be found in close proximity to other OspC residues due to protein folding. 23. Kumaran et. al. (2001). (2001). nAlpha Helix 5 region/domain. This is the OspC region that contains residues that correspond with amino acids 160-200 of strain B31 (OspC Type A) sequence, as shown in FIG. 23 and the C-terminal section of the protein (amino acid 201-210 of B31 sequence), are not shown in FIG. 23. The Strain OspC secondary structural elements of Strain B31 OspC are located in the following region: loop 6, alpha-helix 5, and unstructured Cterminal domain. (2001). The terms?protein’ and?polypeptide are interchangeable. The terms?protein?,?polypeptide? and?peptide can be interchangeably used herein. The terms?peptide? and?peptide can be interchanged herein. ?multivalent? Or?multivalent? The number of OspC-specific epitope bearing polypeptides in the chimeric vaccinegen. A divalent chimera could be made up of alpha-helix 5 and alpha-helix 5 from type A, or alpha and loop 5 and type A, respectively. One OspC protein may be associated with invasive infections. If Borrelia OspC types have been isolated from human infections other than the area of tick bite inoculation (e.g. .).”from plasma, cerebrospinal liquid, etc
“The invention provides recombinant, chimeric proteins that contain multiple linear epitopes in the loop 5 or alpha helix 5, at least two of which are different OspC types associated with invasive infections. A single chimeric protein can contain antigenic epitopes that range from 2 to 20 and more preferably, 6 to 10. Although at least two epitopes may be different in primary sequence and come from different OspC types it is possible to include multiple epitopes in a chimera or include several sequences that are derived or based on the original OspC type. Although the number of linear epitopes within a chimera will vary, it is likely to be between 10 and 20. One embodiment of the invention uses immunodominant epitopes that are chosen from OspC type Smar, PMit and SL10, PHi, SL10 and HT22. Other combinations that may be suitable include: 1) E N, I C, A B, K. D; 2) A B, K. D, E N, C; and 3) I C, C. A. B. K. D; and 4) C. A. B. K. D.
“In some embodiments, the loop 5 as well as the alpha helix 5, regions will be included. An?E?, N?, I?, C? A, B? K, D? example. An OspC type E, N,I, C, A. B. K, D. construct could contain both the loop 5 or helix 5 regions. You could include the loop 5 region from type A, as well as the alpha-helix 5 regions from OspC types E, N. I, C. B, K and D. Or, you may only include the loop 5 regions for each OspC type; or the alpha Helix 5 region. Other combinations are possible, too (e.g. Loop 5 region of type A and the alpha-helix 5 region region of type B and K may be included.
“The linear order of epitopes in a chimera can vary. The order from amino to carboxyl terminus will be:?loop 5, alpha-helix 5 area, loop 5, alpha-helix 5 regional, alphahelix 5 regions, alphahelix 5region, and alphahelix 5 area. . . ? etc. In the case of E, N. I, C. A, B. K, and D constructs, the preferred order is:?E-type Loop 5 Region, E-type Alpha Helix 5 Region; N-type Loop 5 Region, N-type Alpha Helix 5 Area; I-type Loop 5 Region, I-type Alpha helix5 region . . ?, etc. The length of the chimera with the OspC types, and/or domains, optionally separated by neutral linking sequences. This order can change depending on elements included in the chimera. You can use any order of OspC domains and OspC types, provided that the resulting chimera generates an appropriate immune response or is effective in diagnosing Lyme disease. FIG. shows some examples of chimera sequences. 25A-J. FIG. shows a tabular representation of the OspC accession numbers from various Borrelia strains. 26.”
“The amino acids sequences in the chimeric proteins may include the alpha helix 5, and/or loop 5 regions or antigenic fragments thereof. By ?antigenic fragment? We mean any segment of OspC that has at least one linear epitope identified during infection. This epitope is expressed in OspC’s recombinant protein unit. It can bind infection-induced antibody in a similar manner to wild-type proteins expressed on the cell surface. One antigenic fragment might contain multiple epitopes. The art of measuring the affinity or avidity for an epitope by antibodies is not always precise. Also, the affinity/avidity may change during the immune response (e.g. By affinity maturations/somatic highmutataiton. The affinity/avidity for binding antibodies to the chimeric proteins is generally between about 50% and 60%. Preferably, it is about 70%. More preferably, about 70%. Most preferably, about 90-100%. This is higher than native, intact alpha 5, or loop 5. The antigenic sequences in the chimeric protein will generally contain between 20 and 100 amino acids. Preferably, they will be between 30 and 70 amino acids. The chimeric protein itself will contain about 160 to 800 amino acids. Preferably, they will have between 240 and 560 amino acid. The antigenic sequences can also be called?epitopes? regardless of whether they contain an entire ‘natural? As long as they have the antibodies binding characteristics described herein, epitopes may be used.
“Alternatively, antigen fragments, antigenic sequences, or epitopes that are appropriate may be identified by their ability to induce suitable antibody production in the epitope when they are included in a Chimeric Protein. The definitions of antibody titre may be different for those skilled in the art. Herein, ?titer? ?titer? is the inverse dilution (or dilute) of an antiserum to bind half the binding sites on an ELISA coated with 100 ng test protein. An antibody titer of about 100 to 100,000 is considered to be suitable for production. Preferably, it should be between 10,000 and 10,000,000. In diagnostic assays, however, the ‘titer’ could be used to indicate whether or not there is a suitable antibody production process. The background level of binding should be at least three times the?titer? To be considered positive, the reactivity measured in a test must be at least three times higher than that detected in serum from healthy individuals. The antibody response should be protective. Prevents or lessens symptoms of disease in a vaccinated person who is later exposed to Borrelia.
FIG. 9B shows the amino acid sequence for an exemplary chimeric protein as per the invention. 9B. 9B. OspC is known from Borrelia strains and could be used in the practice or the invention.
“Those skilled in the art will know that while some embodiments correspond to the primary amino acids sequence of OspC proteins, it is not necessary. An epitope’s amino acid sequence may be modified slightly to make it suitable for the present invention. Certain conservative amino acid substitutions can be made that do not have a detrimental effect on the epitope’s ability to provoke an immune response. These conservative substitutions are easily recognized by those skilled in the art. They include substitutions of positively charged amino acids for other positively charged amino acids, substitutions of negatively charged amino acids for another negatively charged, and substitutions of hydrophobic amino acids for another hydrophobic. The present invention is intended to cover all such substitutions and alterations to the sequence of an epitope in the chimeric proteins of the invention so long as the resulting epitope continues to trigger an appropriate immune response. The chimeric proteins of invention do not have to contain a full-length native epitope, or an epitope-containing area. For the purposes of the invention, it may be preferred to use truncated amino acid sequences that have epitopes. However, the sequence must meet the criteria for epitope. Amino acids sequences that have been so substituted or altered may be called?based on?. These amino acid sequences may be referred to as?based on? oder?derived from? The original wild type sequence or the native sequence. The OspC proteins that the linear epitopes are derived from? The OspC proteins from which the linear epitopes were?derived? These OspC proteins are as found in nature. These OspC natural proteins can alternatively be called native or wildtype proteins.
These changes may be made to the primary sequence for a variety reasons. They can be used to remove or insert a protease site, increase or decrease solubility or promote or discourage inter-molecular interactions like a folding, ionic interaction, salt bridges, etc., which could otherwise hinder the accessibility and presentation of individual epitopes throughout the length of the Chimera. The present invention is intended to cover all such modifications, provided that the resulting amino acids sequence triggers an antibody reaction against the OspC type from where the epitope originated. These substituted sequences should be at least 50% identical to their native counterparts, preferable 60 to 70 or 70 to 80 or 80 to 90% identical, and preferably 95 to about 100% identical.
“In some embodiments, the linear epitopes within the chimeric vaccinegen can be separated by interspersed sequences that are more neutral or less neutral. They do not elicit an immune reaction to Borrelia. These sequences could be found between epitopes in chimeras. They may be present between epitopes of chimeras. If they are, they could serve to isolate epitopes from one another. These sequences could also be an artifact of recombinant processes, e.g. Cloning procedures. These sequences are commonly known as space or linker peptides. Many examples are available to those skilled in the art. Crasto, C. J., and J. A. Feng. 2000. LINKER: A program that generates linker sequences to fusion proteins. Protein Engineering 13(5), 309-312 is a reference which describes unstructured links. Structured linkers (e.g. Structured (e.g.
“In addition to the elements mentioned above, there may also be other elements in the chimeric protein, such as leader sequences and sequences that?tag?” The protein is used to aid in purification and detection. Examples of these elements include histidine tags, detection tag (e.g. S-tag or Flag-tag, other antigenic amino acids sequences, such as known sequences containing T-cell epitopes and protein stabilizing motif sequences, are all possible. Chemical modification of chimeric proteins is possible, e.g. By amidation, sulfurylation, or lipidation, as well as other techniques that are available to those skilled in the art.
“The invention also provides nucleic acids sequences that encode the chimeric protein of the invention. These nucleic acids can be DNA, RNA, or hybrids thereof. The invention also covers vectors that contain or house such coding sequences. Examples of suitable vectors are, but are not limited, plasmids and cosmids as well as viral-based vectors and expression vectors. A preferred embodiment of the vector is a plasmid-expression vector.
“The invention’s chimeric proteins can be made by any method that is suitable, many of which are well-known to those skilled in the art. The proteins can be made chemically or using recombinantDNA technology (e.g. In bacterial cells, in cells (mammalian or yeast), in plants, or by cell-free prokaryotic and eukaryotic based expression systems. The present invention provides compositions that can be used to elicit an immune response. This could be used as a vaccine against Borrelia infection, especially Lyme disease (Lyme Borreliosis). We mean that the antigen is administered to cause the production of antibodies at a specific titer (as described above) or cellular proliferation as measured e.g. By 3H thymidine integration. By ?vaccine? We mean a chimeric protein which triggers an immune response that results in protection against Borrelia challenge. This protects the body from developing symptoms associated with Borrelia infection. Lyme disease symptoms, compared to non-vaccinated people (e.g. as an adjunct to control organisms. The compositions contain one or more substantially purified, recombinant Chimeric Proteins as described herein and a pharmacologically acceptable carrier. The composition may contain a plurality of chimeric protein combinations, which could be different or the same. The composition could be called a “cocktail”. The composition may contain a combination of several chimeras or one type. Those skilled in the art are familiar with the preparation of vaccine compositions. These compositions are usually prepared as liquid solutions or suspensions. However, solid forms like tablets, pills and powders can also be considered. You can also prepare solid forms that are suitable for suspension or solution in liquids before administration. You can also emulsify the preparation. You can mix the active ingredients with excipients that are compatible and pharmaceutically acceptable. Water, saline or dextrose, glucose, ethanol, or combinations thereof, are all acceptable excipients. The composition may also contain small amounts of auxiliary substances, such as pH buffering agents, wetting or emulsifying agent, and the like. An adjuvant may be added to vaccine preparations according to the invention. Examples include Seppic, Quil A and Alhydrogel. You can add flavorings, thickeners, dispersing aids, binders or other ingredients to the composition to make it easier to swallow. Any such ingredients may be added to the composition of the invention in order to make it suitable for administration. There may be variations in the final amount of chimeric proteins contained in the formulations. The formulations generally contain between 0.01 and 99 percent of chimeric protein, weight/volume.
The methods include administering a composition containing a chimeric protein recombinant in a pharmacologically acceptable carrier for a mammal. The present invention allows for the administration of vaccine preparations by many methods well-known to those skilled in the art. These include injections, oral, intramuscular, intranasally, and ingestion of food products containing the chimeric protein. Preferably, the method of administration is intramuscular or subcutaneous. The compositions can also be used in combination with other treatments, such as chemotherapeutic agents or substances that boost immunity.
“The invention provides methods for eliciting an immune response against Borrelia in mammals and to vaccine against Borrelia infection in humans. One embodiment of the mammal is a person. But, anyone skilled in the art will know that there are other mammals for which vaccinations might be beneficial, e.g. The preparations can also be used for veterinary purposes. These include, but are not limited too, companion pets? companion pets? such as dogs and cats, etc. ; animals used for food, work, and recreation, such as cattle, horses and oxen; wild animals that are Borrelia reservoirs (e.g. mice, deer). The invention provides a diagnostic tool and a method to use the diagnostic to identify individuals with antibodies to the chimeric proteins. A biological sample taken from an individual (e.g. A biological sample from an individual (e.g., a human or a deer) is taken and contacted with the chimeric protein of the invention. The presence or absence of a binding reaction is determined using a well-known method. If the result is positive (binding takes place, so antibodies are present), it means that the individual has been infected or exposed to Borrelia. This is why, depending on the purpose of the analysis, chimeras that are specific for OspC types of interest may be created. All OspC types can be included or excluded from the diagnostic chimera.
“Further the diagnostic features of the invention aren’t limited to clinical use or at home, but can also be useful in the laboratory as research tools, e.g. To identify Borrelia spinochetes from ticks and to study the geographic distribution of OspC types.
“The present invention also includes antibodies to the epitopes, and/or to chimeric proteins described herein. These antibodies can be monoclonal, polyclonal, or chimeric and may be created in any way known to those skilled in the art. The preferred embodiment of the invention is that the antibodies are bactericidal, or borreliacidal. Borrelia spirochetes can be exposed to the antibodies and cause death. These antibodies can be used in many ways, including: As detection reagents for diagnosing prior Borrelia exposure, in kits to investigate Borrelia, or to treat Borrelia infections.
The following examples illustrate different embodiments of the invention. However, they should not be construed as limiting.
“EXAMPLES”
“Example 1”
“Demonstration and identification of previously uncharacterized epitopes that define the OspC Antibody Response Specificity”
“Introduction”
Lyme disease can be transmitted to humans by the bite of Ixodes ticks that have been infected with Borrelia burgdorferi (B. garinii), or B. afzelii. OspC (outer surface protein C) is believed to play an important role in the transmission of Lyme disease and in the establishment or early infection in mammals (Grimm, Parl, and Al, 2004; Schwan, et. al., 1995). OspC is a variable, ?22 kDa, surface exposed, plasmid-encoded lipoprotein (Fuchs et al., 1992; Marconi et al., 1993; Sadziene et al., 1993). Three OspC proteins have their crystal structures determined (Eicken and al., 2001; Kumaran and al., 2001). The protein is largely helical and has 5 alpha-helices that are connected by variable loops. It has been suggested that the loops may form ligand binding domains (Eicken and al. 2001; Kumaran and al. 2001). OspC is believed to facilitate the translocation of tick spirochetes into the tick’s midgut. It acts as an adhesin and binds to unknown receptors in the salivary. (Pal, et al., 2004). OspC orthologs have been found in several Borrelia species, raising the possibility of OspC-related proteins playing a similar role in Borrelia species (Marconi and colleagues, 1993; Margolis and colleagues, 1994). OspC expression can be regulated by tick-feeding, and OspC acts as a dominant antigen in early infection of mammals (Alverson, Schwan, 1998; Stevenson, 1995). The RpoN/S regulatory system regulates transcription (Hubner and al., 2001). There are contradicting reports on the exact details of OspC expression in the temporal context of transmission and early infection (Ohnishi, Schwan, 1995).
“OspC displays significant genetic and antigenic diversity” (Theisen, 1995; Theisen, 1993). One hundred and one OspC type phyletic groups have been identified (Seinost, Wang, et. al. 1999). OspC types can be distinguished by their letter designations (A-U). Analysing several hundred OspC sequences found in the databases shows that OspC types may diverge up to 30%, while within one type it is usually less than 6%. Seinost et al. Seinost et. al. (1999) hypothesized that there is a correlation between OspC type A, B, I, and K and invasive diseases in humans. Lagal et al. Lagal et. al. reported that invasive human infections can be correlated with specific ospC variants as determined by single-strand conformation analysis. Alghaferi and his colleagues have recently questioned the strength of this correlation. This area of research is important and very fertile. It concerns the influence of OspC sequence or type on function and host-pathogen interaction. OspC has been studied for Lyme disease vaccine development (Bockenstedt and al. 1997; Gilmore et al., 2003; Gilmore et al., 1999a; Probert et al., 1994; Theisen et al, 1993; Wilske et al, 1996). OspC variation, as well as limited knowledge about the antigenic structure of OspC, have made these efforts more difficult. OspC is capable of protecting against the same strain, but only (Bockenstedt and al. 1997; Gilmore et al., 1999; Gilmore et al., 1999b; Probert and LeFebvre, 1994; Wilske et al, 1996). This suggests that protective epitopes are located in regions of the protein with high sequence variability.
“This study had multiple goals. The first was to further assess the correlation between OspC type invasive infections and OspC type invasive infections. This was done by determining OspC types of invasive and uninvasive isolates from a Maryland patient population. To better understand the type-specific antibody response to OspC was also sought. The antigenic structure of OspC has been defined by identifying epitopes in mice that trigger an antibody response. These data show that OspC types are more common than previously thought (Seinost and al. 1999). We have also identified two previously unknown epitopes, and shown that OspC’s antibody response is type-specific. These analyses have important information that will help us understand the role OspC plays in Lyme disease pathogenesis.
“Experimental Procedures”
“Bacterial Isolates and Cultivation of Infection Serum”
“TABLE 1nBacterial isolates and source information. burgdorferinIsolate source OspC typenB31MI AnLDP56 Blood AnLDP61 Blood AnLDP76 Personal blood AnLDP73 Personal skin AnLDS101 HnLDP84 HnLDP63 HnLDP74 HnLDP121 Human CSF NnLDP120 HnLDP74 HnLDP81 Human skin KnLDS88 KnLDP116 DnDNA Isolation and Computer-Assisted Structur Anas
“TABLE?2\nPolymerase?Chain?Reaction?Primers?employed\nin?this?study.\nSEQ?ID\nPrimer Sequence?a NO:\nospC?20(+)?LIC GACGACGACAAGATTAATAATTCAGG 163\nGAAAGATGGG\nospC?40(+)?LIC GACGACGACAAGATTCCTAATCTTAC 165\nAGAAATAAGTAAAAAAAT\nospC?60(+)?LIC GACGACGACAAGATTAAAGAGGTTGA 165\nAGCGTTGCT\nospC?80(+)?LIC GACGACGACAAGATTAAAATACACCA 166\nAAATAATGGTTTG\nospC?100(+)?LIC GACGACGACAAGATTGGAGCTTATGC 167\nAATATCAACCC\nospC?130(+)?LIC GACGACGACAAGATTTGTTCTGAAAC 168\nATTTACTAATAAATTAAAAG\nospC?136(+)?LIC GACGACGACAAGATTAATAAATTAAA 169\nAGAAAAACACACAGATCTTG\nospC?142(+)?LIC GACGACGACAAGATTCACACAGATCT 170\nTGGTAAAGAAGG\nospC?151(+)?LIC GACGACGACAAGATTACTGATGCTGA 171\nTGCAAAAGAAG\nospC?171(+)?LIC GACGACGACAAGATTGAAGAACTTGG 172\nAAAATTATTTGAATC\nospC?191(+)?LIC GACGACGACAAGATTCTTGCTAATTC 173\nAGTTAAAGAGCTTAC\nospC?130(? )?LIC GACGACAAGCCCGGTTTAACATTTCT 174\nTAGCCGCATCAATTTTTTC\nospC?150(? )?LIC GACGACAAGCCCGGTTTAAACACCTT 175\nCTTTACCAAGATCTGT\nospC?170(? )?LIC GACGACAAGCCCGGTTTAAGCACCTT 176\nTAGTTTTAGTACCATT\nospC?190(? )?LIC GACGACAAGCCCGGTTTACATCTCTT 177\nTAGCTGCTTTTGACA\nospC?200(? )?LIC GACGACAAGCCCGGTTTAGCTTGTAA 178\nTGCTCTTAACTGAATTAGC\nospC?210(? )?LIC GACGACAAGCCCGGTTTAAGGTTTTT 179\nTTGGACTTTCTGC\na LIC tail sequences are underlined\n\nGeneration of Recombinant Proteins.”
“To generate full length OspC and truncations, primers were based on the type a ospC sequence from B. burgdorferi B31MI. (Fraser et al. 1997). These primers have tail sequences that enable annealing into pET32 Ek/LIC vectors (Novagen), as well as ligase-independent cloning (LIC), and expression vectors. All LIC procedures were described previously (Hovis et. al., 2004). Recombinant plasmids from E. coli NovaBlue cells (DE3) were purified using QiaFilter Midi Plasmid Purification Kits (Qiagen). The inserts were then sequenced (MWG Biotech).
“SDS-PAGE & Immunoblot Analyses”
“Proteins were isolated in 12.5% Criterion precast gels (Biorad) using SDS-PAGE. They were then immunoblotted onto PVDF membranes [Millipore] as previously described by Roberts et. al., 2002. S-Protein horseradish oxidase conjugate (Novagen) confirmed the expression of recombinant protein. This detects the Nterminal S-Tag Fusion that is carried in all recombinant protein used in this study. A dilution of 1:1000 was used for the HRP conjugated S-Protein. The dilution of serum from infected mice for immunoblot analysis was 1:1000. The secondary (Pierce), was HRP conjugated goat anti mouse IgG. It was used at 1:10,000 dilution. The general immunoblot procedures were described in Metts et. al. 2003.
“Results”
“ospC Typing Analysis Of Isolates Recovered From Human Lyme Disease Patients In Maryland”
“ospC was amplified successfully from all the isolates analyzed, which were taken from Lyme patients from Maryland. To determine OspC type (FIG), the sequences of each amplified amplicon were determined. Comparative sequence analyses were also performed. 1). There were representatives of many OspC types, including A (n=6) and B (n=1) as well as C (n=1) and D (n=1) respectively. Invasive infections in humans are usually associated with OspC type A, B, C, I, and K, as previously reported by Sinost et. al. (1999). Invasive isolates were those found in blood, organs, or cerebrospinal fluid. Non-invasive isolates, however, were those that were not found elsewhere (Seinost and al., 1999). It was shown that OspC type C, D, or N isolates were found in blood (LDP84, LDP63 and LDP116) and cerebrospinal fluids (LDC83). These isolates are therefore invasive. This observation indicates that OspC type correlations with invasive infections may not be as strong as previously thought.
“Analysis on the Type Specificity and Antibody Response to OspC during Infection in Mice.”
To determine whether the OspC antibody response to infection is type-specific, type A, C, D and H recombinant OspC protein proteins were created. The recombinant proteins of B. burgdorferi were immunoblotted with serum from mice infected (as shown in FIG. 2). The expression of the recombinant proteins was confirmed in E. coli by screening an immunoblot using HRP conjugated S.Protein. This antibody recognizes the S.Tag in the N.terminal fusion. Screened with anti-B. Strong reactivity was only detected with type A protein when the burgdorferi antiserum B31MI (type A OspC), was collected at week 2 of infection. The strong and rapid IgG response to OspC was consistent with previous reports (Theisen, Wilske, and al., 1995). The sera taken at week 8 of infection showed strong cross immunoreactivity with OspC types but a weak reaction to OspC type D and B. LDP116 and LDP73 were OspC type B and D isolates, respectively. The Ab response to OspC was also type-specific. The antibody response to OspC is highly type-specific. This means that in vivo immunodominant epitopes reside within the type-specific domains of the protein.
“Localization and Antibody Response in Mice to OspC Linear Epitopes”
“To identify the epitopes that trigger an antibody response during infection, several OspC fragments were generated. These fragments were then screened with?B. burgdorferi B31MI infected serum (wk 8) (FIG. 3). B31MI is an OspC Type A producing strain. Immunoblotting using the HRP conjugated S-Protein confirmed the expression of the recombinant protein. Immunoblots of OspC fragments were tested with infection serum to identify the linear epitopes. Two domains that contained one or more epitopes in OspC were identified. One was located within the C-terminal portion of the protein between residues 162 and 203 of alpha Helix 5, and the other between residues 136, 150, and loop 5. (henceforth, the alpha 5 and loop 5- epitopes respectively). These epitopes were not previously described in the literature.
“ospC Sequence Analysis and Computer Modeling OspC Structure”
“To determine the location of the loop 5 and alpha5 epitopes spatially on the OspC proteins, coordinates determined using X-ray crystallographic analyses by Eicken et. al. 2001; Kumaran, et. al. 2001 were accessed. Ribbon and space fill models were then generated for monomeric or dimeric forms type A OspC (data is not shown). Models were also created for monomeric forms of the E OspC and type I OspC proteins. These analyses showed that the loop 5 epitope was surface exposed on both monomeric and dimeric types of type I, E, and I OspC protein proteins. X-ray crystallographic analysis revealed that portions of both C-termini and N- were not included in the recombinant proteins. The determined structures show that the N-termini and C-termini are located in close proximity and are proximal the cell membrane.
227 OspC sequences were aligned to assess sequence variation within loop 5 and alpha 5, at the intra-type levels. The analyses showed that the loop 5 and the alpha 5 epitopes were highly variable at inter-type levels, but are remarkably conserved within one type. FIG. FIG. The inter-type conservation of loop 5 was demonstrated by the comparison of 53 type A loop 5 epitopes sequences. Only one or two residues were different in the outlying sequences. Similar observations were made for the alpha5 epitopes. 42 of 43 type A OspC sequences were identical between residues168 and 203. We found fewer alpha5 epitope sequences than expected, as many of the sequences in the databases were incomplete and did not contain sufficient C-terminus.
“Demonstration of the Antibody Response to Loop 5 Epitope Is Not Unique to an Individual Mouse.”
“Considering the low length and intra-type conservation, loop 5 might be a good candidate for the development of an OspC loop5 based vaccinegen. The loop 5 epitope was a common infection site and the antibody response was consistent across the entire animal. Immunoblots of loop 5 containing 130 to 150 fragments were tested with serum from other OspC-producing strains B31MI, LDP56, and 5A4. This epitope was recognized by antibody in all cases (FIG. 5). Loop 5 had a weaker response in LDP56-infected mice 2 and longer exposure revealed that loop 5 was an antigenic agent in this animal. This shows that these epitopes can cause an immune response in multiple animals and is therefore useful for vaccine development.
“Discussion”
“OspC has been clearly shown to be an important contributor to Lyme Disease Pathogenesis (Grimm and al., 2004; Pal and al., 2004; Schwan and al., 1995). It is clear that it plays a significant role in the Lyme disease spirochetes transit from the midgut to salivary gland. (Pal and al., 2004). It is also expressed in a selective manner during early infection and is an immunodominant antibody (Fingerle, 1995; Schwan, 1998; Wilske, 1993). Other researchers have suggested that it plays a critical role in Lyme disease isolate dissemination (Seinost, 1999). This study was designed to determine the possible correlation between OspC type infection and invasive infection. It also determined if OspC’s antibody response is type-specific. The antigenic structure of OspC was further defined by locating the linear epitopes present during infection.
“Sequence analysis of OspC has delineated 21 distinct OspC kinds (Seinost and al. 1999). It is believed that only four (types A and B, I, and K) are associated to invasive infections in people (Seinost and al. 1999). Alghaferi and colleagues (2005) have questioned this supposed correlation. This was further addressed by determining the OspC type and non-invasive Lyme diseases isolates from Maryland patients. The full length of the ospC gene was sequenced, PCR amplified and comparative sequence analyses were conducted to accomplish this. These analyses showed that OspC types involved in invasive human infection in this patient population also included types C, D and N. However, none of the invasive strains found in Maryland patients had a type I OspC. Similarly, Alghaferi et al. Alghaferi and colleagues, 2005 also failed to detect OspC-producing strains of type I. These two studies collectively identified 18 invasive strains in Baltimore. The breakdown is as follows: A, B, C, D, H, N, 7 and C, n=5 respectively. In this area, OspC types A and N are the most common. These data support the notion that only 4 OspC types can cause invasive infections in humans. To further evaluate the validity of OspC type?invasive infections correlation and determine if there are differences in the prevalences of OspC types within defined geographic regions, additional analyses will be needed.
“The combination of OspC vaccination and the identification of different OspC types raises the possibility that an antibody response may be specific to a particular type. This hypothesis is supported in part by the fact OspC vaccination has been shown to protect against the same strain (Bockenstadt and al., 1997; Gilmore and al., 1999a; Probert & LeFebvre 1994). The type specificity of OspC’s antibody response during infection was not directly evaluated until this report. This was addressed by screening full-length recombinant OspC protein types A, B and C with infection serum in mice expressing known OspC type. Because it allows for the evaluation of antibody responses to epitopes specific to the bacterium in-vivo, the importance of using infection serum is crucial. These analyses showed that despite strong sequence conservation in the N- and C-terminal domains OspC, the type specific antibody response to OspC types was evident. For example, serum from mice infected with type A or D strains was immunoreactive in a type specific manner with little or no cross-immunoreactivity with other OspC types. The data above indicate that although the antibody response to 21 OspC types wasn’t analyzed, they aren’t immunodominant. Furthermore, the linear epitopes presented by OspC during infection were found within the variable domains of the protein (i.e. type specific domains).
“Only a handful of studies have been published that attempted to identify or localize the epitopes for OspC. It has been possible to identify both conformational and linear epitopes. Gilmore and Mbow showed that the monoclonal antibody, B5, is not bound by independent N terminal deletions. They can be as short as 6 residues, or as long as 13 residues. This revealed that the monoclonal antibody B5 recognizes a conformationally-defined epitope (Gilmore and co-authors, 1999b). It was not possible to identify the exact residues that make up this antibody recognition site within this epitope. Contrary to the monoclonal antibody, B5, the analysis of the polyclonal response to native OspC showed that OspC was not recognized by IgG during infection even though the C-terminal 10 residues were removed. The difference in results may be due to the emphasis on monoclonal and polyclonal antibodies. These data, while not denying the existence of conformational epitopes do show that OspC also contains linear epitopes. In an earlier study, Mathieson et al. Mathieson et. al., 1998 also reported on OspC’s linear epitope. The linear epitope in OspC’s C-terminal 7 residues was identified by IgM from serum taken from European neuroborreliosis sufferers. Although IgM binding was not evaluated in this report, OspC’s deletion of the 10 C-terminal residues did not eliminate IgG binding. The protein’s epitopes that are recognized and induced by infection appear to be located at multiple sites. This does not mean that an epitope at the C-terminal of the protein is absent or not recognized by IgG elicited during infected. It just means that there may be additional epitopes elsewhere in OspC.
“Immunoblot analysis on shorter OspC fragments enabled for more precise localizations of OspC epitopes. Two regions were identified as the antigenic regions for OspC. The one covers residues 136 to 150, while the other covers residues from 168 up to 210. Structural models based on coordinates from Xray diffraction analyses place residues 136 to 150 largely within a loop called loop 5. (Kumaran et. al., 2001). Loop 5 is visible in both mono- and dimeric OspC models and is located within an obvious bend. Although it has been shown that OspC can form dimers in vitro, it is not known if native OspC can make larger oligomers or dimers. A significant buried interface of OspC that is greater than 30% indicates a dimeric model. This buried interface is thought to indicate a tight interaction of monomers. The OspC dimer’s loop 5 contains residues that are thought to be part of a conformationally defined ligand binding pouch. This pocket may have biological significance. The charged pocket is lined with amino acids that contain carbonyl groups, such as glutamate or aspartate residues. Three OspC proteins types A, I and E have their crystal structures determined by Kumaran et. al. 2001. The solvent structures of the putative binding pocket in all three OspC proteins are well conserved. Loop 5 is accessible to antibody in the infection serum, supporting the hypothesis that this domain might be surface exposed and available for ligand binding. The sequence of the domain is highly variable at inter-type levels despite strong inter-type structural conservation for loop 5 and the putative binding pocket. The sequence of alpha 5 domain residues 168-210 is variable at the intertype level, with the exception of 20 residues that are highly conserved. OspC sequences were aligned to determine if there is enough conservation at the intra-type level for the construction a chimeric OspC vaccination that consists of a series epitopes specific to each type. A dendogram was then constructed. These analyses revealed that the OspC type for 227 sequences was determined (data not shown). Both the loop 5 (alpha 5) and the alpha 5 epitopes of type A OspC proteins were well conserved at intra-type levels. The loop 5 epitopes of type OspC OspC proteins were found to be identical in 54 sequences, while the alpha5 epitope was conserved within 42 of 43 sequences. These domains were also conserved in other OspC types, with types C through M, N, and O showing absolute intra-type conservation within their loop 5 and alpha5 epitopes.
“This study shows that OspC diversity is greater among invasive isolates than was previously thought. This study also shows that OspC antibody responses in mice are largely type-specific and are defined by previously unknown loop 5 and alpha5 epitopes. The data presented here and earlier studies clearly show that OspC proteins do not provide protection against all strains. (Bockenstedt, 1997). A possible vaccine approach is to use the epitopes in this report for the development of a recombinant OspC vaccinegen. If they are consistently antigenic in humans, the loop 5 epitope (or a combination thereof) may be most promising. These epitopes have a relatively short length, are linear and highly conserved at intra-type levels. It should be technically possible to create a loop 5-alpha-5 chimeric vaccinegen that provides protection against Lyme disease isolates of high severity.
“Example 2”
“Analysis and Evaluation of Antibody Response in Humans To the Type A OspC Loop 5 Domain”
“Outer surface protein (OspC), a 22-kDa antigen in Lyme disease spirochetes, is produced upon tick feeding and early stages of infection. (Schwan et Al, 1995). OspC produces strong antibodies during natural infection. However, this response doesn’t lead to bacterial elimination because OspC production ceases shortly after infection has been established (Schwan and al. 1995). OspC has been identified as a key virulence factor, and is a candidate for Lyme disease vaccine development. The heterogeneity of OspC among strains has hampered efforts to create an OspC-based vaccine (Theisen and Al, 1993; Wilske, et. al, 1996; Wilske, et. al, 1993). Although vaccination with OspC elicits a highly protective response, most studies have reported only strain-specific protection (Bockenstedt et al, 1997; Gilmore et al, 1996; Mbow et al, n 1999; Probert et al, 1997; Rousselle et al, 1998; Scheiblhofer et al., 2003). Recent studies have given us important insight into the antigenic structure and basis of OspC’s strain-specific protection. There are 21 OspC types (designated A through U by Lagal et. al. 2003; Seinost and al. 1999; Wang et. al. 1999). It was shown that early infection by Borrelia burgdorferi clonal populations in mice is OspC-specific (see Example 1). This indicates that OspC type-specific domains are where the epitopes most prevalent during early infection. Although earlier studies indicated that only 4 OspC types were associated with invasive infections (Seinost and al. 1999), more recent research has shown that OspC isolates can cause invasive infections (Alghaferi, et. al. 2005; Example 1). Type A OspC seems to dominate in strains that can cause invasive infections in humans. The loop 5 domain was the epitope that provokes the most response in mice according to epitope mapping analyses. (See Example 1). The loop 5 domain is highly variable between types, but it is conserved within a specific type’s sequences (see Example 1). We refine the epitope’s location, show its exposure to intact bacteria and demonstrate that it produces bactericidal antibodies.
“To better define the loop 5 domain residues that are recognized as infection-induced antibodies, PepSpot arrays have been screened with sera from patients 8 to 44 and serum from mice infected by a clonal population from the type A OspC producing strain B31MI (see example 1). PepSpot arrays contained 12- to 13-residue, overlapping peptides (two amino-acid step), that covered the loop 5 domain (type A OspC) and were spotted onto Whatman 50 cellulose membrane (150 nmol/cm2 JPT Peptide Technologies GmbH Berlin, Germany). After blocking the membranes with 5% nonfat dry milk in Tris buffered saline-0.5%Tween 20, they were washed and screened using mouse and human serum samples (1:1,000 and 1:1400 respectively). Antibody binding was detected using species-specific anti IgG antiserum. Although the exact residues of the immunoreactive domain were slightly different in mice and humans the main epitopes were located within residues 130-146 (FIG. 7). This region includes the C-terminal area of alpha helix 3, and the N-terminal section of loop 5.
“Several reports have provided strong support for the development Lyme disease vaccines (reviewed by Hanson and Edelman 2004). Currently, however, there is no commercially available vaccine. Baxter attempted to create a vaccine cocktail that contained 14 full-length rOspC proteins in an attempt to develop a broad Lyme disease vaccine (Hanson & Edelman, 2004). The cocktail was rejected as being too reactigenic. Reactigenicity could have been due to the high amount of protein required to provoke a sufficient response against the OspC types of OspC proteins in the cocktail. Cocktail vaccines that contain multiple full-length proteins have the potential to misdirect the antibody response to nonprotective, conserved epitopes. This problem could be overcome by creating a chimeric, human-derived r-vaccinogen that contains the naturally occurring immunodominant linear epitopes from each dominant OspC type. This concept was developed in the development of malarial vaccines by using epitopes derived from different proteins at different stages (Hanson & Edelman, 2004). This same concept was used in the creation of a hexavalent M-protein vaccine for group A streptococci (Dale 1999); Fan et. al., 2005, Horvath et. al., 2005, Kotloff, McNeil, 2005, Wang et. al., 2005). It may be possible to create an OspC vaccine that is r-polyvalent and chimeric with new information. This vaccine could include the newly identified loop 5 domain.
“Example 3”
“Development an OspC – Based Tetravalent, Recombinant and Chimeric Vacinogen”
Lyme disease is the most prevalent arthropod-borne disease in North America, Europe and North America. There is currently no vaccine that can be used to treat Lyme disease in humans. Outer surface proteinC (OspC), which has attractive antigenic and expression properties, has been hampered from being used as a vaccine. 21 OspC types or phyletic groups have been identified by sequence analysis. (designated A-U). This study describes the mapping of OspC type B, K, and D linear epitopes during human and murine infections and their exploitation (alongside the previously identified OspC type A OspC line epitopes) for the development of a recombinant tetravalent, Chimeric Vaccininogen. The construct was highly immunogenic in mice, and the induced antibodies were labeled with in vitro cultivated Spirochetes. Importantly, vaccination produced complement-dependent bactericidal antibody against each OspC type that was incorporated into the construct. These results indicate that a recombinant, modified protein can be made to produce a protective and effective OspC-based Lyme vaccine.
“Materials & Methods”
“Borrelia burgdorferi Cultivation and Isolates”
“Ligase Independent Cloning of OspC Proteins and Production of Recombinant (r) OspC Proteins.”
“TABLE?3\nPCR?primers?used?in?the?generation?of?various?OspC?type?fragments.\nPrimer Sequence Description SEQ?ID?NO:\nospC20(+)LIC GACGACGACAAGATTAAT Amplifies?OspC 180\nAATTCAGGGAAAGATGGG from?aa?20?and\nadds?LIC?tail\nospC210(+)LIC GACGACAAGCCCGGTTTA Amplifies?OspC?up 181\nAGGTTTTTTTGGACTTTC to?aa?210?and?adds\nTGC LIC?tail\nOCB110LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?B 182\nTTGTGTTATTAAGGTTGA up?to?aa?110?and\nTATTG adds?LIC?tail\nOCB131LIC(+) GACGACGACAAGATCTTC Amplifies?type?B 183\nTGAAGAGTTTAGTACTAA from?aa?131?and\nACTAAAA adds?LIC?tail\nOCB140LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?B 184\nTTTTAGTTTAGTACTAAA up?to?aa?140?and\nCTCTTCAG adds?LIC?tail\nOCB140LIC(+) GACGACGACAAGATAGAT Amplifies?type?B 185\nAATCATGCACAGCTTGGT from?aa?140?and\nATACAG adds?LIC?tail\nOCB148LIC(+) GACGACGACAAGATTATA Amplifies?type?B 186\nCAGGGCGTTACTGATGAA from?aa?148?and\nAATGC adds?LIC?tail\nOCB153LIC(+) GACGACGACAAGATTGAA Amplifies?type?B 187\nAATGCAAAAAAAGCTATT from?aa?153?and\nTTAAAA adds?LIC?tail\nOCB155LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?B 188\nTGCATTTTCATCAGTAAC up?to?aa?155?and\nGCCCTG adds?LIC?tail\nOCB164LIC(+) GACGACGACAAGATTGCA Amplifies?type?B 189\nGCGGGTAAAGATAAGGGC from?aa?164?and\nGTTGAAG adds?LIC?tail\nOCB169LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?B 190\nCTTATCTTTACCCGCTGC up?to?aa?169?and\nadds?LIC?tail\nOCB175LIC(+) GACGACGACAAGATTGAA Amplifies?type?B 191\nAAGTTGTCCGGATCATTA from?aa?175?and\nGAAAGC adds?LIC?tail\nOCB180LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?B 192\nTGATCCGGACAACTTTTC up?to?aa?180?and\nAAGTTCTTC adds?LIC?tail\nOCB181LIC(+) GACGACGACAAGATCTTA Amplifies?type?B 193\nGAAAGCTTATCGAAAGCA from?aa?181?and\nGCTAAAGAG adds?LIC?tail\nOCB185LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?B 194\nTGATTAAGCTTTCTAATG up?to?aa?185?and\nATCCGGAC adds?LIC?tail\nOCB190LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?B 195\nCTCTTTAGCTGCTTTTGA up?to?aa?190?and\nTAAGCTTC adds?LIC?tail\nOCB200LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?B 196\nTGTAAGCTCTTTAACTGA and?K?up?to?aa?200\nATTAGCAAG and?adds?LIC?tail\nOCB49LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?B 197\nAATTTTTTTACTTATTTC and?D?up?to?aa?49\nTGTAAG and?adds?LIC?tail\nOCB80LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?B 198\nTTTTTTACCAATAGCTTT up?to?aa?80?and\nAGCAAGCTC adds?LIC?tail\nOCD112LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?D 199\nTAATTTTTCTGTTATTAG up?to?aa?112?and\nAGCTG adds?LIC?tail\nOCD130LIC(+) GACGACGACAAGATTAAA Amplifies?type?D 200\nTGTTCTGAAAGCTTTAC from?aa?130?and\nadds?LIC?tail\nOCD135LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?D 201\nAAAGCTTTCAGAAACATT up?to?aa?135?and\nTCTTAGC adds?LIC?tail\nOCD135LIC(+) GACGACGACAAGATTACT Amplifies?type?D 202\nAAAAAACTATCAGATAAT from?aa?135?and\nCAAGCAG adds?LIC?tail\nOCD144LIC(+) GACGACGACAAGATTGAG Amplifies?type?D 203\nCTTGGTATAGAGAATGCT from?aa?144?and\nACTGATG adds?LIC?tail\nOCD151LIC(+) GACGACGACAAGATTGCT Amplifies?type?D 204\nACTGATGATAATGCAAAA from?aa?151?and\nAAGGC adds?LIC?tail\nOCD155LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?D 205\nATTATCATCAGTAGCATT up?to?aa?155?and\nCTCTATACC adds?LIC?tail\nOCD166LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?D 206\nAGCATTATGTGTTTTTAA up?to?aa?166?and\nAATAGCC adds?LIC?tail\nOCD167LIC(+) GACGACGACAAGATTAAA Amplifies?type?D 207\nGACAAGGGTGCTGAAGAA from?aa?167?and\nCTTG adds?LIC?tail\nOCD180LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?D 208\nTGATTCAGATAACTTTAC up?to?aa?180?and\nAAGTTC adds?LIC?tail\nOCD180LIC(+) GACGACGACAAGATTTCA Amplifies?type?D 209\nGTAGCAGGCTTATTAAAA from?aa?180?and\nGCAGCTC adds?LIC?tail\nOCD195LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?D 210\nTGAATTAGCCAGTATGGC up?to?aa?195?and\nTTGAGCTGC adds?LIC?tail\nOCD195LIC(+) GACGACGACAAGATTTCA Amplifies?type?D 211\nGTTAAAGAGCTTACAAGT from?aa?195?and\nCCTG adds?LIC?tail\nOCD80LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?D 212\nATCTATTTTTTTACCAAT up?to?aa?80?and\nA adds?LIC?tail\nOCK110LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?K 213\nTTGTGTTATTAGTTTTGA up?to?aa?110?and\nTATTG adds?LIC?tail\nOCK130LIC(+) GATGACGACGACAAGATT Amplifies?type?K 214\nAAATGTTCTGAAGATTTT from?aa?130?and\nAC adds?LIC?tail\nOCK135LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?K 215\nAAAATCTTCAGAACATTT up?to?aa?135?and\nCTTAGC adds?LIC?tail\nOCK148LIC(+) GATGACGACGACAAGATA Amplifies?type?K 216\nATTGAAAATGTTACTGAT from?aa?148?and\nGAGAATGC adds?LIC?tail\nOCK150LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?K 217\nATTTTCAATTCCAAGTTG up?to?aa?150?and\nCGCATGTTC adds?LIC?tail\nOCK160LIC(+) GATGACGACGACAAGATT Amplifies?type?K 218\nATTTTAATAACAGATGCA from?aa?160?and\nGCTAAAG adds?LIC?tail\nOCK166LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?K 219\nAGCTGCATCTGTTATTAA up?to?aa?166?and\nAATAGC adds?LIC?tail\nOCK175LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?K 220\nTTCAAGCTCTGCAGCGCC up?to?aa?175?and\nCTTATC adds?LIC?tail\nOCK180LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?K 221\nTGCTTTAAATAGCTTTTC up?to?aa?180?and\nAAGCTCTGC adds?LIC?tail\nOCK180LIC(+) GATGACGACGACAAGATT Amplifies?type?K 222\nGCAGTAGAAACTTGGCAA from?aa?180?and\nAAGCAGC adds?LIC?tail\nOCK190LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?K 223\nCTCTTTAGCTGCTTTTGC up?to?aa?190?and\nCTTGTTTTC adds?LIC?tail\nOCK191LIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?K 224\nCATCTCTTTAGCTGCTTT up?to?aa?191?and\nTGCCAAG adds?LIC?tail\nOCK8OLIC(?) GAGGAGAAGCCCGGTTTA Amplifies?type?K 225\nTTTTTTACCAATAGCTTT up?to?aa?80?and\nAGTAGC adds?LIC?tail\nLIC tails are in bold.\n\nImmunoblot Analyses: Epitope Mapping of OspC Types B, D, and K.”
“To map epitopes that are relevant during infection, C3H/HeJ mouse were infected by 104 spirochetes from clonal populations OspC types K, D. Blood was collected at weeks 2, 4, 6, 8, 8 and 12, and tail bleeding. These sera were used for screening OspC proteins and other truncations, as shown in Example 1. The r-proteins were subjected a SDS-PAGE analysis, transferred to PVDF and screened using a 1:1000 dilution (collected at week 6). The r-proteins were also screened using serum (1:400), from patients who had been infected by a B.burgdorferi strain that carries OspC type B, K or D. (kindly provided Dr. Allen Steere). The appropriate IgG specific, horseradish-peroxidase-conjugated secondary antibody was used. The results were visualized using chemiluminescence.
“Construction of a Tetravalent Chimeric Viral Vaccinogen”
“TABLE?4\nPCR?primers?used?in?the?generation?of?the?ABKD?chimeric?vaccinogen.\nPrimer Sequence Description SEQ?ID?NO:\nOCAL5LIC(+) GACGACGACAAGATTTCTG Amplifies?type?A 226\nAAACATTTACTAATAAATTA from?aa?131?and\nAAAGAAAAAC adds?LIC?tail\nOCAL5L1(?) TAACATACCCATGCTACCTTC Amplifies?type?A?up 227\nTTTACCAAGATCTGTGTG to?aa?149?and?adds\nlinker?1? (GSMGML;\nSEQ?ID?76)\nOCBH5L1(+) GGTAGCATGGGTATGTTAAA Amplifies?type?B 228\nAGCAAATGCAGCGGG from?aa?160?and\nadds?linker?1\n(GSMGML;\nSEQ?ID?76)\nOCBH5L2(?) TAAGTTACCGTTTGTGCTTGT Amplifies?type?B?up 229\nAAGCTCTTTAACTGAATTAG to?aa?201?and?adds\nlinker?2? (STNGNL;\nSEQ?ID?77)\nOCKH5L2(+) AGCACAAACGGTAACTTAAT Amplifies?type?K 230\nAACAGATGCAGCTAAAGATA from?aa?161?and\nAGG adds?linker?2\n(STNGNL;\nSEQ?ID?77)\nOCKH5L3(?) TAAAACGCTCATGCTACTTGT Amplifies?type?K?up 231\nAAGCTCTTTAACTGAATTAGC to?aa?201?and?adds\nlinker?3? (SSMSVL;\nSEQ?ID?78)\nOCDH5L3(+) AGTAGCATGAGCGTTTTAAA Amplifies?type?D 232\nAACACATAATGCTAAAGACA from?aa?161?and\nAG adds?linker?3\n(SSMSVL;\nSEQ?ID?78)\nOCDH5LIC(?) GAGGAGAAGCCCGGTTTAA Amplifies?type?D?up 233\nCTTGTAAGCTCTTTAACTGAA to?aa?201?and?adds\nTTAG an?LIC?tail\nLIC tails are in bold, and linker sequences are underlined.\n\nImmunization of Mice with the Tetravalent ABKD Chimeric Vaccinogen.”
Twelve six-week old male C3H/HeJ strain, male mice were given 50 g of the chimeric vaccinegen in a 1:1 mixture with complete Freund’s adjuvant. The total dose of the vaccinogen was 200 mL. It was administered intraperitoneally and subcutaneously in two separate depots. Three control mice received sham vaccinations with PBS in CFA. The mice were given 50 g of Freund’s incomplete adjuvant protein at weeks 2 and 4. Sham-immunized mice were given PBS as adjuvant. Before the first injection, all mice were bled with tail nick. This was repeated at week 6.
“Assessment on the Immunogenicity for the ABKD Chimeric Vaccinogen.”
“Immunoglobulin Isotype Profiling the Anti-ABKD Antibody Reaction.”
“The isotype profile for the anti-ABKD antibody reaction was determined by coating duplicate ELISA plates using 100 ng of the chimeric construct. After washing the plates, they were blocked according to the above procedure. Anti-ABKD antibodies from 12 vaccinated mice were collected in duplicate and analysed (100?L, 1:10000; 1 hr). Bound vaccinogen specific Ig was detected after incubation (1 hr) with biotinylated secondary antibody (1 hr). Bound biotinylated antibodies were detected using HRP-conjugated streptavidin (30 minutes) and the chromogenic substrate ABTS. All incubations took place at room temperature.
“Indirect Immunofluorescence assays (IFA)”
Click here to view the patent on Google Patents.